GtRNAdb

tRNAscan-SE Analysis of Rickettsia conorii

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


Rickettsia_conorii_str_Malish_7.trna27 (712478-712403)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (712445-712443)	Score: 81.73
Seq: GGGGTCATAGCTCAGTTGGTAGAGTGTTTGAATGGCATTCAAAAGGtCGGGGGTTCGACTCCCCCTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna26 (822253-822179)	Length: 75 bp
Type: Ala	Anticodon: TGC at 33-35 (822221-822219)	Score: 90.65
Seq: GGGGGCATAGCTCAGGGGTAGAGCATCTGCTTTGCACGCAGAGGGtCAAGGGTTCGATTCCCTTTGCCTCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna12 (781318-781394)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (781352-781354)	Score: 76.03
Seq: GCACCCGTAGCTCAATTGGAtAGAGTATATGACTACGGATCATAAGGtTAGGGGTTCGACTCCTCTCGGGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna10 (696562-696638)	Length: 77 bp
Type: Arg	Anticodon: CCG at 35-37 (696596-696598)	Score: 79.19
Seq: GCATTCGTAGCTCAGCTGGAtAGAGCGTTGCCCTCCGAAGGCAAAGGtCGTTGGTTCAAATCCAATCGAATGCACTA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna21 (1203341-1203265)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (1203307-1203305)	Score: 92.66
Seq: GCACCCTTAGCTCAGCTGGAtAGAGCAACAGATTTCTAATCTGTGGGtCAGAGGTTCGAATCCTTTAGGGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna6 (368645-368719)	Length: 75 bp
Type: Asn	Anticodon: GTT at 33-35 (368677-368679)	Score: 81.23
Seq: TCCTCGGTAGCTTAGTGGTAGAGCAAACGGCTGTTAACCGTTCGGtCGCTGGTTCGAGTCCGGCCCGGGGAGCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna31 (618512-618436)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (618478-618476)	Score: 95.14
Seq: GGGGGTGTAGCTCAGTTGGTtAGAGCATCTGCCTGTCACGCAGAAGGtCGCGGGTTCGAGTCCCGTCACTCTCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna7 (484281-484355)	Length: 75 bp
Type: Cys	Anticodon: GCA at 33-35 (484313-484315)	Score: 65.82
Seq: GGCTGGGTAGCAAAGTGGTAATGCCGTGGACTGCAAATCCTCTATtCGTCGGTTCGATTCCGACCCTGGCCTCCA
Str: >>>>>>>..>>>.........<<<.>.>>>.......<<<.<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna28 (696830-696757)	Length: 74 bp
Type: Gln	Anticodon: TTG at 33-35 (696798-696796)	Score: 67.26
Seq: TGGGACGTCGCCAAGTGGTAAGGCAACGGTTTTTGGTATCGTCAtCGGAGGTTCGAATCCTCCCGTCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna1 (23116-23190)	Length: 75 bp
Type: Glu	Anticodon: TTC at 34-36 (23149-23151)	Score: 73.92
Seq: GGCCCCTTCGTCTAGTGGTtAGGACACCACCCTTTCACGGTGGGAACACGGGTTCGAGTCCCGTAGGGGTCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna14 (838946-839020)	Length: 75 bp
Type: Gly	Anticodon: GCC at 33-35 (838978-838980)	Score: 83.04
Seq: GCGGGTGTAGCTCAGGGGTAGAGCGCCACCTTGCCAAGGTTGAAGtCGAGGGTTCGAATCCCTTCACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>.>>>.......<<<.<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna24 (935799-935726)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (935767-935765)	Score: 79.61
Seq: GCGGGTGTAGCTCAATGGTAGAGTTCCAGCCTTCCAAGCTGGCTGTGTGGGTTCGATTCCCATCACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna16 (992644-992720)	Length: 77 bp
Type: His	Anticodon: GTG at 35-37 (992678-992680)	Score: 84.84
Seq: GCGGGTGTAGCTCAGTTGGTtAGAGCATCAGGTTGTGGTTCTGAGGGtCGCGGGTTCGAATCCCGTCACTCGCCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna9 (515115-515191)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (515149-515151)	Score: 95.68
Seq: GGGTTTGTAGCTCAGCTGGTtAGAGCACACGCCTGATAAGCGTGAGGtCGGAAGTTCAAGTCTTCTCAAACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna13 (834174-834260)	Length: 87 bp
Type: Leu	Anticodon: GAG at 35-37 (834208-834210)	Score: 62.56
Seq: GCGGTCGTGGCGAAATTGGTaGACGCGCAGCATTGAGGGTGCTGTTCTGTAAAAAGAtTGGAAGTTCAAGTCTTCTCGACCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>......<<...>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna15 (947443-947528)	Length: 86 bp
Type: Leu	Anticodon: TAA at 34-36 (947476-947478)	Score: 74.10
Seq: GCCCGCGTGATGGAATGGTaGACATAACGGACTTAAAATCCGTGGAGCGTAAGCTCtTGCCGGTTCAAGTCCGGCCGCGGGTACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<..>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna20 (1249347-1249263)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (1249313-1249311)	Score: 62.23
Seq: GCGGATGTGATGGAACTGGTaGACATGCAAGATTTAGGTTCTTGTGCCGTGAGGCGTGGGGGTTCAAGTCCCTTCATCCGTACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna8 (515025-515100)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (515058-515060)	Score: 91.62
Seq: GAGCTCGTAGCTCAGTCGGTAGAGCATTTGACTTTTAATCAAAGGGtCCCGGGTTCAAATCCCGGCGAGCTCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna3 (129858-129934)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (129892-129894)	Score: 83.22
Seq: TGCGGGGTGGAGCAGCTtGGTAGCTCGTCAGGCTCATAACCTGAAGGtCGTTGGTTCAAATCCAGCCCCCGCTACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Rickettsia_conorii_str_Malish_7.trna5 (320146-320222)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (320180-320182)	Score: 87.57
Seq: GGCGGGGTAGCTCAGCTGGTtAGAGCGACGGAATCATAATCCGTGTGtCGGGGGTTCAAATCCCTCCCTCGCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna22 (1096177-1096101)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1096143-1096141)	Score: 97.58
Seq: GGGGCTGTAGCTCAGTTGGTtAGAGCACGCCGCTCATAACGGTGTGGtCGTAGGTTCAAGTCCTACCAGCCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna33 (9671-9596)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (9638-9636)	Score: 92.67
Seq: GGCCACGTAGCTCAGTCGGTAGAGCAAAGGACTGAAAATCCTTGTGtCGTTGGTTCAATTCCAACCGTGGCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna18 (1167246-1167322)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (1167280-1167282)	Score: 88.88
Seq: CGGGGCGTAGCGCAGCCtGGTAGCGCATCTGGTTTGGGACCAGAGGGtCGGGAGTTCGAATCTCTCCGCCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna17 (1040211-1040302)	Length: 92 bp
Type: Ser	Anticodon: GCT at 35-37 (1040245-1040247)	Score: 70.67
Seq: GGAGAGATGGCCGAGTGGCcgAAGGCGGCGGTTTGCTAAACCGTTATACGGGTCAtACCGTATCGAGGGTTCGAATCCCTCTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>......<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna30 (659618-659531)	Length: 88 bp
Type: Ser	Anticodon: GGA at 35-37 (659584-659582)	Score: 81.89
Seq: GGAGAGATGGCCGAGTGGTttAAGGCGCACGCCTGGAAAGCGTGTTCACGGCAACGTGtCGGGGGTTCGAATCCCCCTCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna29 (682033-681944)	Length: 90 bp
Type: Ser	Anticodon: TGA at 35-37 (681999-681997)	Score: 76.94
Seq: GGGTAGGTGGCCGAGTGGTttAAGGCACTAGTCTTGAAAACTGGCGTACGGGCAACCGTACCGTGGGTTCGAATCCCACCCTATCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna32 (208895-208820)	Length: 76 bp
Type: Thr	Anticodon: CGT at 34-36 (208862-208860)	Score: 87.05
Seq: GCCGATGTAGCTCAGCTGGTAGAGCGGCGCATTCGTAATGCGTAGGtCTGGGGTTCAAATCCCCACATTGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna2 (103652-103726)	Length: 75 bp
Type: Thr	Anticodon: GGT at 33-35 (103684-103686)	Score: 89.47
Seq: GCTACTATAGCTCAGGGGTAGAGCACTTCATTGGTAATGAAGAGGtCGGGGGTTCGATTCCCCCTAGTAGCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna19 (1256518-1256444)	Length: 75 bp
Type: Thr	Anticodon: TGT at 33-35 (1256486-1256484)	Score: 91.18
Seq: GCCGGATTAGCTCAGTGGTAGAGCAACCGCCTTGTAAGCGGTAGGtCATCAGTTCAAATCCGATATCCGGCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna4 (174538-174613)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (174571-174573)	Score: 78.90
Seq: AGGAGTGTAGCTCAATTGGTAGAGCGCCGGTCTCCAAAACCGGAGGtTGCGGGTTCGATACCTGTCGCTCCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna23 (936020-935935)	Length: 86 bp
Type: Tyr	Anticodon: GTA at 35-37 (935986-935984)	Score: 72.41
Seq: GGAGGGGTGGCCGAGTGGTcaATGGCAGCAGACTGTAAATCTGCCCGCGTAAGCGTtCGAAGGTTCAAATCCTTCTCCCTCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna11 (716649-716725)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (716683-716685)	Score: 86.74
Seq: GGGTGATTAGCTCAGTTGGTtAGAGCATTACGTTGACATCGTAAAGGtCGGTGGTTCGAGCCCACTATCACTCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Rickettsia_conorii_str_Malish_7.trna25 (920336-920261)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (920303-920301)	Score: 89.91
Seq: GGGCGATTAGCTCAGCTGGTAGAGTATCTCGTTTACACCGAGAGTGtCGGCGGTTCGAGTCCGTCATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.