GtRNAdb

tRNAscan-SE Analysis of Pseudomonas fluorescens Pf-5

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


Pseudomonas_fluorescens_Pf-5.trna16 (2279398-2279473)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (2279431-2279433)	Score: 86.95
Seq: GGGGCTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCGACGGTTCGATCCCGTCTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna18 (2279681-2279756)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (2279714-2279716)	Score: 86.95
Seq: GGGGCTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCGACGGTTCGATCCCGTCTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna20 (2279964-2280039)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (2279997-2279999)	Score: 86.95
Seq: GGGGCTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCGACGGTTCGATCCCGTCTAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna2 (124560-124635)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (124593-124595)	Score: 93.85
Seq: GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna33 (6386204-6386129)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (6386171-6386169)	Score: 93.85
Seq: GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna4 (855801-855876)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (855834-855836)	Score: 93.85
Seq: GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna43 (6012384-6012309)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (6012351-6012349)	Score: 93.85
Seq: GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna55 (4813432-4813357)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (4813399-4813397)	Score: 93.85
Seq: GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTTGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna47 (5213643-5213567)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (5213609-5213607)	Score: 85.86
Seq: GCACTCGTAGCTCAGCTGGAtAGAGTACTCGGCTACGAACCGAGCGGtCACAGGTTCGAATCCTGTCGAGTGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna48 (5213494-5213418)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (5213460-5213458)	Score: 85.86
Seq: GCACTCGTAGCTCAGCTGGAtAGAGTACTCGGCTACGAACCGAGCGGtCACAGGTTCGAATCCTGTCGAGTGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna71 (215582-215506)	Length: 77 bp
Type: Arg	Anticodon: CCG at 35-37 (215548-215546)	Score: 86.39
Seq: GCACTCGTAGCTCAGCTGGAtAGAGTACTGCCCTCCGAAGGCAGGGGtCGTGGGTTCGAATCCCGCCGAGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna49 (5209446-5209370)	Length: 77 bp
Type: Arg	Anticodon: CCT at 35-37 (5209412-5209410)	Score: 82.39
Seq: GTCTCAGTAGCTCAATTGGAtAGAGCATCCCCCTCCTAAGGGGAAGGtTGGCAGTTCGAACCTGCCCTGGGACACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna56 (4608534-4608458)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (4608500-4608498)	Score: 96.39
Seq: GCGCCCGTAGCTCAGCTGGAtAGAGCATCCGCCTTCTAAGCGGATGGtCGCAGGTTCGAGTCCTGCCGGGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna63 (2270317-2270242)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (2270284-2270282)	Score: 87.87
Seq: TCCGCGATAGCTCAGTTGGTAGAGCAAGTGACTGTTAATCACTGGGtCCCTGGTTCGAGTCCAGGTCGTGGAGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna38 (6068511-6068436)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (6068478-6068476)	Score: 89.90
Seq: TCCGTGATAGCTCAGTCGGTAGAGCAAATGACTGTTAATCATTGGGtCCCAGGTTCGAGTCCTGGTCACGGAGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna23 (2307727-2307803)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2307761-2307763)	Score: 94.67
Seq: GCAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna24 (2307906-2307982)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (2307940-2307942)	Score: 94.67
Seq: GCAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna51 (5113069-5112993)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (5113035-5113033)	Score: 94.67
Seq: GCAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna53 (5112710-5112634)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (5112676-5112674)	Score: 94.67
Seq: GCAGCGGTAGTTCAGTCGGTtAGAATACCGGCCTGTCACGCCGGGGGtCGCGGGTTCGAGTCCCGTCCGCTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna60 (3982121-3982048)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (3982089-3982087)	Score: 64.59
Seq: GGCCGAGTAGCAAAATGGTTATGCAGCGGATTGCAAATCCGCCTACGCCGGTTCGATTCCGACCTCGGCCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>.>>>.......<<<.<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna29 (5924323-5924397)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (5924355-5924357)	Score: 66.82
Seq: AGGGGCGTCGCCAAGCGGTAAGGCAGCAGGTTTTGATCCTGCCATgCGTTGGTTCGAATCCAGCCGCCCCTGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna62 (3070627-3070553)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (3070595-3070593)	Score: 66.82
Seq: AGGGGCGTCGCCAAGCGGTAAGGCAGCAGGTTTTGATCCTGCCATgCGTTGGTTCGAATCCAGCCGCCCCTGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna11 (1967091-1967166)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (1967125-1967127)	Score: 66.40
Seq: GTCCCCTTCGTCTAGTGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAGTCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna13 (1967350-1967425)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (1967384-1967386)	Score: 66.40
Seq: GTCCCCTTCGTCTAGTGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAGTCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna17 (2279553-2279628)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (2279587-2279589)	Score: 66.40
Seq: GTCCCCTTCGTCTAGTGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAGTCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna19 (2279836-2279911)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (2279870-2279872)	Score: 66.40
Seq: GTCCCCTTCGTCTAGTGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAGTCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna21 (2280118-2280193)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (2280152-2280154)	Score: 66.40
Seq: GTCCCCTTCGTCTAGTGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAGTCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna9 (1966832-1966907)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (1966866-1966868)	Score: 66.40
Seq: GTCCCCTTCGTCTAGTGGCctAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAGTCCCCTAGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna64 (1608448-1608375)	Length: 74 bp
Type: Gly	Anticodon: CCC at 33-35 (1608416-1608414)	Score: 57.71
Seq: GCGGGTGTCGTATAATGGCATTACTCCAGCTTCCCAAGCTGATAACGAGGGTTCGATTCCCTTCACCCGCTCCA
Str: >>>>>>>..>>>.........<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna10 (1966910-1966985)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1966943-1966945)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna12 (1967170-1967245)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1967203-1967205)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna14 (1967429-1967504)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1967462-1967464)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna59 (4108029-4107954)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (4107996-4107994)	Score: 93.74
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGtCGCGAGTTCGAGTCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna35 (6380757-6380684)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (6380725-6380723)	Score: 79.05
Seq: GCGGGTATAGTTTAGTGGTAGAACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCCCGCTACCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna57 (4608425-4608350)	Length: 76 bp
Type: His	Anticodon: GTG at 34-36 (4608392-4608390)	Score: 82.99
Seq: GTGGGCGTAGCTCAGTTGGTAGAGCACAGGATTGTGACTCCTGTTGtCGTGGGTTCGATCCCCATCGTCCACCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna1 (124473-124549)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (124507-124509)	Score: 98.83
Seq: GGGTCTGTAGCTCAGTTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGCAGTTCGAATCTGCCCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna3 (855714-855790)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (855748-855750)	Score: 98.83
Seq: GGGTCTGTAGCTCAGTTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGCAGTTCGAATCTGCCCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna32 (6386291-6386215)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (6386257-6386255)	Score: 98.83
Seq: GGGTCTGTAGCTCAGTTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGCAGTTCGAATCTGCCCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna42 (6012471-6012395)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (6012437-6012435)	Score: 98.83
Seq: GGGTCTGTAGCTCAGTTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGCAGTTCGAATCTGCCCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna54 (4813519-4813443)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (4813485-4813483)	Score: 98.83
Seq: GGGTCTGTAGCTCAGTTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGCAGTTCGAATCTGCCCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna28 (5728407-5728491)	Length: 85 bp
Type: Leu	Anticodon: CAA at 35-37 (5728441-5728443)	Score: 73.20
Seq: GCCCTGATGGCGGAATTGGTaGACGCGGCGGATTCAAAATCCGTTTTCGCAAGAAGTGGGAGTTCGAGTCTCCCTCGGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna68 (670873-670787)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (670839-670837)	Score: 74.03
Seq: GCCCAGATGGTGAAATTGGTaGACACGCCAGCTTCAGGTGCTGGTGACCGCAAGGTCGTGGAAGTTCGAGTCTTCTTCTGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna67 (671125-671039)	Length: 87 bp
Type: Leu	Anticodon: CAG at 35-37 (671091-671089)	Score: 76.03
Seq: GCCCAGATGGTGAAATTGGTaGACACGCCAGCTTCAGGTGCTGGTGGCCGCAAGGCCGTGGAAGTTCGAGTCTTCTTCTGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna5 (970963-971048)	Length: 86 bp
Type: Leu	Anticodon: GAG at 35-37 (970997-970999)	Score: 64.92
Seq: GCCGAGGTGGTGGAATTGGTaGACACGCAACCTTGAGGTGGTTGTGCCCATAGGGTGTAGGGGTTCGAGTCCCCTTCTCGGTACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>....<<...>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna61 (3944261-3944175)	Length: 87 bp
Type: Leu	Anticodon: TAA at 35-37 (3944227-3944225)	Score: 78.29
Seq: GCCCGAATGGCGAAACTGGTaGACGCATGGGACTTAAAATCCCCCGCTCGTAAGGGCGTGCCGGTTCGATTCCGGCTTCGGGCACCA
Str: >>>>>>>..>>>...........<<<..>>>>.......<<<<..>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna58 (4608292-4608208)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (4608258-4608256)	Score: 74.01
Seq: GCGGACGTGGTGGAATTGGTaGACACACTGGATTTAGGTTCCAGCGCCGCAAGGTGTAAGAGTTCGAGTCTCTTCGTCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna40 (6068344-6068269)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (6068311-6068309)	Score: 92.89
Seq: GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGtCGTAGGTTCGAATCCCACACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna44 (5493586-5493511)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (5493553-5493551)	Score: 92.89
Seq: GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGtCGTAGGTTCGAATCCCACACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna65 (1424848-1424772)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1424814-1424812)	Score: 86.13
Seq: CGCGGGATGGAGCAGTCtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCTCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Pseudomonas_fluorescens_Pf-5.trna66 (1424569-1424493)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1424535-1424533)	Score: 86.13
Seq: CGCGGGATGGAGCAGTCtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCTCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Pseudomonas_fluorescens_Pf-5.trna6 (971145-971221)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (971179-971181)	Score: 86.92
Seq: CGCGGGGTGGAGCAGTCtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
Pseudomonas_fluorescens_Pf-5.trna30 (5940615-5940691)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (5940649-5940651)	Score: 90.17
Seq: GGCTACATAGCTCAGTTGGTtAGAGCATAGCATTCATAATGCTGGGGtCCGGGGTTCAAGTCCCTGTGTAGCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna31 (6455714-6455790)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (6455748-6455750)	Score: 93.84
Seq: GGGCCTATAGCTCAGTTGGTtAGAGCAGAGGACTCATAATCCTTTGGtCCACGGTTCAAGTCCGTGTGGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna69 (409069-408994)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (409036-409034)	Score: 89.80
Seq: GCCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGtCGGCGGTTCGATTCCGTCTCTGGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna26 (2338296-2338372)	Length: 77 bp
Type: Pro	Anticodon: GGG at 35-37 (2338330-2338332)	Score: 73.38
Seq: CGGGGCGTAGCGCAGTCcGGTAGCGCACTAGCATGGGGTGCTAGGGGtCGAGTGTTCGAATCACTCCGTCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna39 (6068426-6068350)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (6068392-6068390)	Score: 83.78
Seq: CGGGGTATAGCGCAGTCcGGTAGCGCGCCTGCTTTGGGAGCAGGATGtCAGGAGTTCGAATCCCCTTACCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna41 (6068173-6068097)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (6068139-6068137)	Score: 83.78
Seq: CGGGGTATAGCGCAGTCcGGTAGCGCGCCTGCTTTGGGAGCAGGATGtCAGGAGTTCGAATCCCCTTACCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna45 (5378541-5378468)	Length: 74 bp
Type: Lys	Anticodon: TTT at 32-34 (5378510-5378508)	Score: 21.34
Seq: CCCTTCCTAGAGCAGTTCAGTCCAATTGTCTTTTAACCAATTGGtCGTAGGTTCGAATCCCACACGACCCACCA
Str: ...>>....>.>>......<<.<.>>>>.........<<<<.....>>.>>.......<<.<<..<<.......
                    
Pseudomonas_fluorescens_Pf-5.trna8 (1640063-1640152)	Length: 90 bp
Type: Ser	Anticodon: CGA at 35-37 (1640097-1640099)	Score: 59.90
Seq: GGAGAGATGCCAGAGTGGCcgAATGGGACGGATTCGAAATCCGTTGTACCTTCACCGGTACCTAGGGTTCGAATCCCTATCTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>......<<<<..>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna46 (5213841-5213751)	Length: 91 bp
Type: Ser	Anticodon: GCT at 35-37 (5213807-5213805)	Score: 66.78
Seq: GGAGAGCTGGCCGAGTGGCcgAAGGCGCTCCCCTGCTAAGGGAGTACACCTCAAaAGGGTGtCGGGGGTTCGAATCCCCCGTTCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>.>.......<.<<...>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna15 (2042089-2042178)	Length: 90 bp
Type: Ser	Anticodon: GGA at 35-37 (2042123-2042125)	Score: 67.56
Seq: GGTGAAGTGTCCGAGTGGCttAAGGAGCACGCCTGGAAAGTGTGTATACAGGAAACTGTATCGAGAGTTCGAATCTCTCCTTCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna27 (4338335-4338422)	Length: 88 bp
Type: Ser	Anticodon: TGA at 35-37 (4338369-4338371)	Score: 68.51
Seq: GGAGGTGTGGCCGAGTGGTttAAGGCAGCGGTCTTGAAAACCGCCGACTGTAAcAGGTcCTAGAGTTCGAATCTCTACGCCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...>>.....<<....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna7 (980179-980254)	Length: 76 bp
Type: Thr	Anticodon: CGT at 34-36 (980212-980214)	Score: 84.52
Seq: GCCGGTGTAGCTCAGTCGGTAGAGCAGCGCACTCGTAACGCGAAGGtCGCAGGTTCGATTCCTGTCTCCGGCACCA
Str: >>>>>.>..>>>>........<<<<..>>>.........<<<......>>>>>.......<<<<<<.<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna36 (6380657-6380582)	Length: 76 bp
Type: Thr	Anticodon: GGT at 34-36 (6380624-6380622)	Score: 91.65
Seq: GCTCTTGTAGCTCAGTTGGTAGAGCACACCCTTGGTAAGGGTGAGGtCAGCGGTTCAAATCCGCTCAAGAGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna70 (374497-374422)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (374464-374462)	Score: 94.51
Seq: GCCGGTATAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGtCCCGGGTTCGACTCCTGGTGCCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna37 (6379249-6379174)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (6379216-6379214)	Score: 86.44
Seq: AGGTCAGTAGCTCAATTGGCAGAGCGACGGTCTCCAAAACCGTAGGtTGGGGGTTCGATTCCCTCCTGACCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna34 (6380866-6380782)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (6380832-6380830)	Score: 70.05
Seq: GGAGGGGTTCCCGAGCGGCcaAAGGGATCAGACTGTAAATCTGACGTCTACGACTtCGAAGGTTCGAATCCTTCCCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>...<<<...>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna25 (2309663-2309739)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (2309697-2309699)	Score: 89.08
Seq: AGGCACGTAGCTCAGTTGGTtAGAGCACCACCTTGACATGGTGGGGGtCGTTGGTTCGAGTCCAATCGCGCCTACCA
Str: >>>>.>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna22 (2307592-2307667)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (2307625-2307627)	Score: 89.92
Seq: GGGTGATTAGCTCAGCCGGGAGAGCGTCTGCCTTACAAGCAGAATGtCGGCGGTTCGATCCCGTCATCACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna50 (5113164-5113089)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (5113131-5113129)	Score: 92.02
Seq: GGGTGATTAGCTCAGCTGGGAGAGCGTCTGCCTTACAAGCAGAATGtCGGCGGTTCGATCCCGTCATCACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
Pseudomonas_fluorescens_Pf-5.trna52 (5112805-5112730)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (5112772-5112770)	Score: 92.02
Seq: GGGTGATTAGCTCAGCTGGGAGAGCGTCTGCCTTACAAGCAGAATGtCGGCGGTTCGATCCCGTCATCACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.