GtRNAdb

tRNAscan-SE Analysis of Pasteurella multocida

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna38 (1312286-1312211)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (1312253-1312251)	Score: 86.24
Seq: GGGGATATAGCTCAGTTGGGAGAGCGCTTGCATGGCATGCAAGAGGtCGTCGGTTCGATCCCGATTATCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna25 (1692340-1692415)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (1692373-1692375)	Score: 93.20
Seq: GGGGATATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTTATCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna3 (343192-343267)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (343225-343227)	Score: 93.20
Seq: GGGGATATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTTATCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna9 (543721-543796)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (543754-543756)	Score: 93.20
Seq: GGGGATATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGtCAGCGGTTCGATCCCGCTTATCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna40 (1246569-1246493)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (1246535-1246533)	Score: 86.34
Seq: GCACCCGTAGCTCAGCTGGAtAGAGTACTCGGCTACGAACCGAGCGGtCAGAGGTTCGAATCCTCTCGGGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna41 (1246427-1246351)	Length: 77 bp
Type: Arg	Anticodon: ACG at 35-37 (1246393-1246391)	Score: 86.34
Seq: GCACCCGTAGCTCAGCTGGAtAGAGTACTCGGCTACGAACCGAGCGGtCAGAGGTTCGAATCCTCTCGGGTGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna5 (541506-541582)	Length: 77 bp
Type: Arg	Anticodon: CCG at 35-37 (541540-541542)	Score: 91.09
Seq: GCGCTCGTAGCTCAGTTGGAtAGAGCGTTGGCCTCCGGAGCCAAAGGtCGCAGGTTCAAATCCTGTCGAGCGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna30 (2170800-2170724)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (2170766-2170764)	Score: 92.02
Seq: GCGCCCTTAGCTCAGCTGGAtAGAGCAACGGCCTTCTAAGCCGTAGGtCATTGGTTCGAATCCAATAGGGCGTGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna23 (1513873-1513948)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (1513906-1513908)	Score: 86.00
Seq: TCCTCCTTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGtCGCTGGTTCAAGTCCAGCAGGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna54 (503044-502969)	Length: 76 bp
Type: Asn	Anticodon: GTT at 34-36 (503011-503009)	Score: 86.00
Seq: TCCTCCTTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGtCGCTGGTTCAAGTCCAGCAGGAGGAGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna56 (131916-131840)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (131882-131880)	Score: 89.09
Seq: GGAGTGGTAGTTCAGCTGGTtAGAATACCTGCCTGTCACGCAGGGGGtCGCGGGTTCGAGTCCCGTCCATTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna36 (1937478-1937402)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (1937444-1937442)	Score: 91.98
Seq: GGAGCGGTAGTTCAGCTGGTtAGAATACCTGCCTGTCACGCAGGGGGtCGCGGGTTCGAGTCCCGTCCGTTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna57 (131824-131748)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (131790-131788)	Score: 91.98
Seq: GGAGCGGTAGTTCAGCTGGTtAGAATACCTGCCTGTCACGCAGGGGGtCGCGGGTTCGAGTCCCGTCCGTTCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna16 (1169500-1169573)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (1169532-1169534)	Score: 52.06
Seq: GGCGTGTTAGCAAAGCGGTTATGCACTGGATTGCAAATCCATGTAGCTCGGTTCGACTCCGGGACACGCCTCCA
Str: >>>>>>>..>>>.........<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna52 (792449-792375)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (792417-792415)	Score: 70.27
Seq: TGGGGTATCGCCAAGCGGTAAGGCACCGGGTTTTGATCTCGGCATtCCTAGGTTCGAATCCTAGTACCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna53 (792329-792255)	Length: 75 bp
Type: Gln	Anticodon: TTG at 33-35 (792297-792295)	Score: 70.27
Seq: TGGGGTATCGCCAAGCGGTAAGGCACCGGGTTTTGATCTCGGCATtCCTAGGTTCGAATCCTAGTACCCCAGCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna26 (1762988-1763063)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (1763022-1763024)	Score: 56.27
Seq: GTCCCCATCGTCTAGAGGCctAGGACATCGCCCTTTCACGGCGGTAACCGGGGTTCGAATCCCCGTGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna35 (1941137-1941062)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (1941103-1941101)	Score: 56.27
Seq: GTCCCCATCGTCTAGAGGCctAGGACATCGCCCTTTCACGGCGGTAACCGGGGTTCGAATCCCCGTGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna46 (1080246-1080171)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (1080212-1080210)	Score: 56.27
Seq: GTCCCCATCGTCTAGAGGCctAGGACATCGCCCTTTCACGGCGGTAACCGGGGTTCGAATCCCCGTGGGGACGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna11 (1059797-1059872)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1059830-1059832)	Score: 92.69
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACAACCTTGCCAAGGTTGGGGtCGCGAGTTCGAGCCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna12 (1059903-1059978)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1059936-1059938)	Score: 92.69
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACAACCTTGCCAAGGTTGGGGtCGCGAGTTCGAGCCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna15 (1169417-1169492)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1169450-1169452)	Score: 92.69
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACAACCTTGCCAAGGTTGGGGtCGCGAGTTCGAGCCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna47 (1007359-1007284)	Length: 76 bp
Type: Gly	Anticodon: GCC at 34-36 (1007326-1007324)	Score: 92.69
Seq: GCGGGAATAGCTCAGTTGGTAGAGCACAACCTTGCCAAGGTTGGGGtCGCGAGTTCGAGCCTCGTTTCCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna33 (1968911-1968837)	Length: 75 bp
Type: Gly	Anticodon: TCC at 34-36 (1968878-1968876)	Score: 64.85
Seq: GCGGGCATCGTATAATGGCtATTACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCCCGCTGCCCGCTCCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna6 (541618-541693)	Length: 76 bp
Type: His	Anticodon: GTG at 34-36 (541651-541653)	Score: 85.05
Seq: GTGGCTATAGCTCAGTTGGTAGAGCCCCGGATTGTGATTCCGGTTGtCGTGGGTTCAAGTCCCATTAGCCACCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna2 (343054-343130)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (343088-343090)	Score: 94.77
Seq: GGGTCTGTAGCTCAGGTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGTGGTTCAAGTCCACTCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna24 (1692202-1692278)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (1692236-1692238)	Score: 94.77
Seq: GGGTCTGTAGCTCAGGTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGTGGTTCAAGTCCACTCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna8 (543583-543659)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (543617-543619)	Score: 94.77
Seq: GGGTCTGTAGCTCAGGTGGTtAGAGCGCACCCCTGATAAGGGTGAGGtCGGTGGTTCAAGTCCACTCAGACCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna55 (347864-347780)	Length: 85 bp
Type: Leu	Anticodon: CAA at 35-37 (347830-347828)	Score: 74.08
Seq: GCCTGGGTGGCGAAATTGGTaGACGCAGTTGATTCAAAATCAACCGCCTTCGGGTGTGCCGGTTCGAGTCCGGCCCTAGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>..<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna1 (234397-234482)	Length: 86 bp
Type: Leu	Anticodon: GAG at 35-37 (234431-234433)	Score: 55.73
Seq: GCTCTGGTGGTGGAATTGGTaGACACGCTATCTTGAGGGGGTAGTGTCCATCGGACGTGCGAGTTCAAGTCTCGCCCAGAGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna17 (1169617-1169703)	Length: 87 bp
Type: Leu	Anticodon: TAA at 35-37 (1169651-1169653)	Score: 71.02
Seq: GCCCGAGTGGTGAAATCGGTaGACACAAGGGATTTAAAATCCCTCGCTTTTCGAAGCGTGCCAGTTCAAGTCTGGCCTCGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna48 (1007257-1007171)	Length: 87 bp
Type: Leu	Anticodon: TAA at 35-37 (1007223-1007221)	Score: 71.02
Seq: GCCCGAGTGGTGAAATCGGTaGACACAAGGGATTTAAAATCCCTCGCTTTTCGAAGCGTGCCAGTTCAAGTCTGGCCTCGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna51 (792563-792479)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (792529-792527)	Score: 68.26
Seq: GCGGGACTGGCGAAATTGGTaGACGCACCAGATTTAGGTTCTGGCGCCGCGAGGTGTGTGGGTTCAAGTCCCTCGTCCCGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>.><.<<<..>.>>>.......<<<.<<<<<<<<....
                    
chr.trna43 (1138787-1138712)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (1138754-1138752)	Score: 97.43
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGCGGACTTTTAATCCGTTGGtCGAAGGTTCGAATCCTTCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna44 (1138668-1138593)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (1138635-1138633)	Score: 97.43
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGCGGACTTTTAATCCGTTGGtCGAAGGTTCGAATCCTTCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna45 (1138549-1138474)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (1138516-1138514)	Score: 97.43
Seq: GGGTCGTTAGCTCAGTCGGTAGAGCAGCGGACTTTTAATCCGTTGGtCGAAGGTTCGAATCCTTCACGACCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna49 (898232-898156)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (898198-898196)	Score: 83.58
Seq: CGCGGGGTGGAGCAGCTtGGTAGCTCGTCGGGCTCATAACCCGAAGGcCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna13 (1096294-1096370)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1096328-1096330)	Score: 88.17
Seq: CGCGGGGTGGAGCAGCTtGGTAGCTCGTCGGGCTCATAACCCGAAGGtCGTCGGTTCAAATCCGGCCCCCGCAACCA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna27 (1862907-1862983)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1862941-1862943)	Score: 93.03
Seq: GCCCCCATAGCTCAGTCGGTcAGAGCAGTCGACTCATAATCGATTGGtCACAGGTTCAAGTCCTGTTGGGGGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna50 (792645-792569)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (792611-792609)	Score: 95.39
Seq: GGCTATGTAGCTCAGTTGGTtAGAGCACAACACTCATAATGTTGGGGtCACAGGTTCGAATCCCGTCATAGCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<....
                    
chr.trna22 (1513793-1513868)	Length: 76 bp
Type: Phe	Anticodon: GAA at 34-36 (1513826-1513828)	Score: 85.75
Seq: GCCTCGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGtCGGTGGTTCGATTCCGCCTCGAGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna29 (2170907-2170831)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (2170873-2170871)	Score: 90.87
Seq: CGGCGAGTAGCGCAGCTtGGTAGCGCAACTGGTTTGGGACCAGTGGGtCGTAGGTTCAAATCCTATCTCGCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna7 (541708-541784)	Length: 77 bp
Type: Pro	Anticodon: TGG at 35-37 (541742-541744)	Score: 90.87
Seq: CGGCGAGTAGCGCAGCTtGGTAGCGCAACTGGTTTGGGACCAGTGGGtCGTAGGTTCAAATCCTATCTCGCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna28 (1994469-1994559)	Length: 91 bp
Type: SeC(p)	Anticodon: TCA at 35-37 (1994503-1994505)	Score: 63.71
Seq: GGAGGAGCGTCGTTTCCGGTGAAGCGGCAGGACTTCAAATCCTGTTGAGGTTGCCAGCAATCTCGGGTGGGTTCGACTCCCATTCTCCTCC
Str: >>>>>>>...>>>>>>....<<<<<<>>>>>>.......<<<<<<>>>>>>>>....<<<<<<<<.>>>>>.......<<<<<.<<<<<<<
                    
chr.trna39 (1246712-1246620)	Length: 93 bp
Type: Ser	Anticodon: GCT at 35-37 (1246678-1246676)	Score: 73.50
Seq: GGTGAGATGGCCGAGAGGCtgAAGGCGCTCCCCTGCTAAGGGAGTATGGGGTCAAAaACTCCATCGAGGGTTCGAATCCCTCTCTCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>>.....<<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna14 (1120194-1120283)	Length: 90 bp
Type: Ser	Anticodon: GGA at 35-37 (1120228-1120230)	Score: 69.27
Seq: GGTGAGATGTCCGAGTGGTtgAAGGAGCACGCCTGGAAAGCGTGTATATGCGAAAGTGTATCGAGGGTTCGAATCCCTCTCTCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna4 (470662-470751)	Length: 90 bp
Type: Ser	Anticodon: TGA at 35-37 (470696-470698)	Score: 71.65
Seq: GGAGGAATGGTCGAGTGGTtgAAGGCACCGGTCTTGAAAACCGGCGAGGGTTTACGCCCTCCGTGAGTTCGAATCTCACTTCCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna42 (1162207-1162118)	Length: 90 bp
Type: Ser	Anticodon: TGA at 35-37 (1162173-1162171)	Score: 71.65
Seq: GGAGGAATGGTCGAGTGGTtgAAGGCACCGGTCTTGAAAACCGGCGAGGGTTTACGCCCTCCGTGAGTTCGAATCTCACTTCCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna34 (1968833-1968758)	Length: 76 bp
Type: Thr	Anticodon: GGT at 34-36 (1968800-1968798)	Score: 96.44
Seq: GCTGATATAGCTCAGTTGGTAGAGCGCACCCTTGGTAAGGGTGAGGtCGGCGGTTCAAATCCGCCTATCAGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna31 (1969147-1969072)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (1969114-1969112)	Score: 91.83
Seq: GCCGACTTAGCTCAGTAGGTAGAGCAACTGACTTGTAATCAGTAGGtCACCAGTTCGATTCCGGTAGTCGGCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>.>.......<.<<<<<<<<<<....
                    
chr.trna37 (1937367-1937292)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (1937334-1937332)	Score: 79.69
Seq: AGGGGCGTAGTTCAATTGGTAGAGCACCGGTCTCCAAAACCGGGTGtTGGGAGTTCGAGCCTCTCCGCCCCTGCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna32 (1969042-1968958)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 35-37 (1969008-1969006)	Score: 69.57
Seq: GGAGGGATTCCCGAGCGGCcaAAGGGAGCAGACTGTAAATCTGCCGGCTCAGCCTtCGAAGGTTCGAATCCTTCTCCCTCCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>...<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna10 (757576-757652)	Length: 77 bp
Type: Val	Anticodon: GAC at 35-37 (757610-757612)	Score: 90.13
Seq: GCGACTATAGCTCAGTTGGTtAGAGCACCACCTTGACATGGTGGGGGtCACTGGTTCGAGTCCAGCTAGTCGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<......>>>>.......<<<<.<<<<<<<....
                    
chr.trna18 (1314001-1314076)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (1314034-1314036)	Score: 90.00
Seq: GGGCGATTAGCTCAGTTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGAGACCGGTATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna19 (1314118-1314193)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (1314151-1314153)	Score: 90.00
Seq: GGGCGATTAGCTCAGTTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGAGACCGGTATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna20 (1314245-1314320)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (1314278-1314280)	Score: 90.00
Seq: GGGCGATTAGCTCAGTTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGAGACCGGTATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna21 (1314384-1314459)	Length: 76 bp
Type: Val	Anticodon: TAC at 34-36 (1314417-1314419)	Score: 90.00
Seq: GGGCGATTAGCTCAGTTGGGAGAGCACCTCCCTTACAAGGAGGGGGtCACTGGTTCGAGACCGGTATCGCCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.