GtRNAdb

tRNAscan-SE Analysis of Nocardioides JS614

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna12 (838947-839022)	Length: 76 bp
Type: Ala	Anticodon: CGC at 34-36 (838980-838982)	Score: 91.13
Seq: GGGGCTGTGGCGCAGTTGGTAGCGCGTCTCGTTCGCAATGAGAAGGtCAGGGGTTCGAATCCCCTCAGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna17 (1942709-1942784)	Length: 76 bp
Type: Ala	Anticodon: GGC at 34-36 (1942742-1942744)	Score: 83.67
Seq: GGGGCTGTGGCGCAGCTGGTAGCGCATCTGCATGGCATGCAGAGGGtCAGGGGTTCGAGTCCCCTCAGCTCCACCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna2 (12276-12351)	Length: 76 bp
Type: Ala	Anticodon: TGC at 34-36 (12309-12311)	Score: 96.01
Seq: GGGGCCTTGGCGCAATTGGTAGCGCACCTGCTTTGCAAGCAGGGGGtTAGGGGTTCGAGTCCCCTAGGCTCCACCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna5 (202663-202735)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (202696-202698)	Score: 72.30
Seq: GCGCCCGTAGCTCAACGGAtAGAGCATCTGACTACGGATCAGAAGGtTTGGGGTTCGAATCCCTACGGGCGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna38 (1850821-1850749)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (1850788-1850786)	Score: 65.10
Seq: GCCTCCGTAGCTCAGGGGAtAGAGCACTGGTTTCCGGTACCAGGTGcCGCAGGTTCGAATCCTGCCGGGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna43 (827324-827249)	Length: 76 bp
Type: Arg	Anticodon: CCT at 34-36 (827291-827289)	Score: 73.81
Seq: GCCCCAGTAGCTCAGCGGAtAGAGCAGCCGCCTCCTAAGCGAAAGGtCGCAGGTTCGACTCCTGCCTGGGGCGCCC
Str: >>>>>>>..>>>>........<<<<...>>>.......<<<.......>>>>>.......<<<<<<<<<<<<....
                    
chr.trna39 (1436523-1436447)	Length: 77 bp
Type: Arg	Anticodon: TCT at 35-37 (1436489-1436487)	Score: 83.25
Seq: GCCCCCGTAGCTCAGCTGGAtAGAGCAGCGGCCTTCTAATCCGCCGGtCGCAGGTTCGAGTCCTGCCGGGGGCGCCT
Str: >>>>>>>..>>>>.........<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna18 (2081097-2081169)	Length: 73 bp
Type: Asn	Anticodon: GTT at 34-36 (2081130-2081132)	Score: 72.45
Seq: TCCCCTGTAGCTCAACTGGCAGAGCATTCGGCTGTTAACCGGAGGGtTGTTGGTTCGAGTCCAACCGGGGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna28 (4533694-4533618)	Length: 77 bp
Type: Asp	Anticodon: GTC at 35-37 (4533660-4533658)	Score: 92.22
Seq: GGCCCCGTAGCGCAGTTGGTtAGCGCGCCGCCCTGTCACGGCGGAGGcCGCGGGTTCGAGTCCCGTCGGGGTCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna36 (2523563-2523490)	Length: 74 bp
Type: Cys	Anticodon: GCA at 33-35 (2523531-2523529)	Score: 71.95
Seq: GGTGGGTTGGCCGAGAGGCGAGGCAACGGACTGCAAATCCGTGTACACGGGTTCAAATCCCGTACCCACCTCCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna32 (3539887-3539813)	Length: 75 bp
Type: Gln	Anticodon: CTG at 34-36 (3539854-3539852)	Score: 59.33
Seq: TGGGATATGGTGTAATTGGCAGCACGACTGGTTCTGGTCCAGTTAGTCTAGGTTCGAGTCCTAGTATCCCAGCGA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna13 (950002-950080)	Length: 79 bp
Type: Gln	Anticodon: TTG at 36-38 (950037-950039)	Score: 34.36
Seq: TCCCCGGTTGGTCTGCCGGCagGGCCCGCCTGACTTTGAATCAGGACTAGcGaCGTAGGTTCGACTCCTACCCGGGGAG
Str: >>>>>>>..>>.>..........<.<<.>>>>>.......<<<<<.........>>>>>.......<<<<<<<<<<<<.
                    
chr.trna33 (3539723-3539648)	Length: 76 bp
Type: Glu	Anticodon: CTC at 35-37 (3539689-3539687)	Score: 72.19
Seq: GCCCCCGTTGTGTAGCGGCctAGCACGCCGCCCTCTCAAGGCGGTAGCGCCGGTTCGAATCCGGTCGGGGGTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna27 (4533884-4533809)	Length: 76 bp
Type: Glu	Anticodon: TTC at 35-37 (4533850-4533848)	Score: 54.80
Seq: GCCCCCATCGTCTAGCGGCccAGGACCCCGCCCTTTCACGGCGGTAGCACGGGTTCGAATCCCGTTGGGGGTGCGA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna26 (4668644-4668719)	Length: 76 bp
Type: Gly	Anticodon: CCC at 34-36 (4668677-4668679)	Score: 90.98
Seq: GCGGATGTAGCTCAGTTGGTAGAGCGCGACCTTCCCAAGGTCGATGtCGCGAGTTCGAGTCTCGTCATCCGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna35 (2523667-2523595)	Length: 73 bp
Type: Gly	Anticodon: GCC at 34-36 (2523634-2523632)	Score: 84.38
Seq: GCGGACGTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGtCGCGAGTTCGAGCCTCGTCGTCCGCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna30 (3691162-3691089)	Length: 74 bp
Type: Gly	Anticodon: TCC at 33-35 (3691130-3691128)	Score: 81.19
Seq: GCGGATGTAGCTCAATGGTAGAGCCCCAGTCTTCCAAACTGGCTACGCGGGTTCGATTCCCGTCATCCGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna40 (1429015-1428940)	Length: 76 bp
Type: His	Anticodon: GTG at 34-36 (1428982-1428980)	Score: 81.01
Seq: GTGGGTGTAGCTCAGCTGGTAGAGCACCTGGTTGTGGTCCAGGTGGcCGCGGGTTCAAGTCCCGTCACTCACCCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna1 (11935-12008)	Length: 74 bp
Type: Ile	Anticodon: GAT at 35-37 (11969-11971)	Score: 87.95
Seq: GGGCCTATAGCTCAGACGGTtAGAGCGCTTCCCTGATAAGGAAGAGGtCACAGGTTCAAGTCCTGTTAGGCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna23 (3215698-3215771)	Length: 74 bp
Type: Leu	Anticodon: CAA at 35-37 (3215732-3215734)	Score: 48.77
Seq: GCCCCGGTATCCCAACCGGCaGAGGAAGCGGTCTCAAACACCGTCCAgTGTGGGTTCGAATCCCACCCGGGGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna3 (32617-32700)	Length: 84 bp
Type: Leu	Anticodon: CAG at 35-37 (32651-32653)	Score: 63.31
Seq: GCGCGAGTGGCGGAATAGGCaGACGCGCACGGTTCAGGTCCGTGTGTCCGAAAGGACGTGGGGGTTCAACTCCCCCCTCGCGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr.trna34 (2788153-2788065)	Length: 89 bp
Type: Leu	Anticodon: GAG at 35-37 (2788119-2788117)	Score: 56.60
Seq: GTCCGGGTGGCGGAATTGGCaGACGCGCTAGCTTGAGGTGCTAGTGCCCGTATtaGGGCGTGGGGGTTCAAGTCCCCCCTCGGACACCC
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>......<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna14 (981354-981430)	Length: 77 bp
Type: Leu	Anticodon: TAA at 35-37 (981388-981390)	Score: 59.80
Seq: GCCCCCGTATCCCAACCGGCaGAGGAAGCCGCCTTAAAAGCGGCGCAgTCTGGGTTCGAGTCCCAGCGGGGGCACCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna42 (1397045-1396961)	Length: 85 bp
Type: Leu	Anticodon: TAG at 35-37 (1397011-1397009)	Score: 61.47
Seq: GCCGAAGTGGTGGAACTGGCaGACACGCGGGTTTTAGGTACCCGTGCCTTCGGGCGTGGGGGTTCAAGTCCCCCCTTCGGCACCC
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>..<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna41 (1410451-1410376)	Length: 76 bp
Type: Lys	Anticodon: CTT at 34-36 (1410418-1410416)	Score: 81.49
Seq: GCGCCATTAGCTCAATTGGCAGAGCAGCTGACTCTTAATCAGCGGGtTCGGGGTTCGAGTCCCTGATGGCGTACCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna24 (4514690-4514765)	Length: 76 bp
Type: Lys	Anticodon: TTT at 34-36 (4514723-4514725)	Score: 75.77
Seq: GGGCCTCTAGCTCAACTGGCAGAGCAGCGGACTTTTAATCCGCGGGtTGTGGGTTCGAGACCCACGGGGCCCACTA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna16 (1693513-1693597)	Length: 85 bp
Type: Met	Anticodon: CAT at 43-45 (1693555-1693557)	Score: 25.21
Seq: AGCGTGGcTTGCAGAGCGGCttGAGGCActtcagaTTGCGCTCATAACCCAGAGGtCGCAGGTTCAAATCCTGCCCCCGCTACAA
Str: >>>>.>>...>>.............<<........>>>.>.......<.<<<.....>>>>>.......<<<<<<<.<<<<....
                    
chr.trna15 (1625605-1625681)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (1625639-1625641)	Score: 80.42
Seq: CGCGGGGTGGAGCAGCTcGGTAGCTCGCTGGGCTCATAACCCAGAGGtCGCAGGTTCAAATCCTGCCCCCGCTACAA
Str: .>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.....
                    
chr.trna10 (709389-709462)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (709423-709425)	Score: 82.28
Seq: GGCGGGGTAGCTCAGGTGGTtAGAGCACACGGCTCATAATCGTGGTGtCGCGGGTTCGAGTCCCGCCCCCGCTA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna19 (2095934-2096010)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (2095968-2095970)	Score: 94.58
Seq: GGGGCGGTAGCTCAGTCGGTcAGAGCAGAGGACTCATAATCCTTGGGtCGTGGGTTCGAGCCCCACCCGCCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna25 (4534026-4534102)	Length: 77 bp
Type: Phe	Anticodon: GAA at 35-37 (4534060-4534062)	Score: 74.31
Seq: GGGCAGGTAGCTCAGTCGGTaCGAGCGTCCGCCTGAAAAGTGGAAGGtCGGCGGTTCGACCCCGCCCCTGCCCACAA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna44 (347193-347117)	Length: 77 bp
Type: Pro	Anticodon: CGG at 35-37 (347159-347157)	Score: 86.74
Seq: CGGGCTGTGGCGCAGCTtGGTAGCGCGCCTCGTTCGGGACGAGGAGGcCGCAGGTTCAAATCCTGTCAGCCCGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna22 (2671978-2672054)	Length: 77 bp
Type: Pro	Anticodon: GGG at 35-37 (2672012-2672014)	Score: 79.87
Seq: CGGGCTGTGGCGCAGCTtGGTAGCGCACTTGACTGGGGGTCAAGGGGtCGCAGGTTCAAATCCTGTCAGCCCGACCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna31 (3691044-3690972)	Length: 73 bp
Type: Pro	Anticodon: TGG at 34-36 (3691011-3691009)	Score: 79.88
Seq: CGGGGCGTAGCGTAGTGGCtAGCGCGCCTGCTTTGGGAGCAGGAGAtCGCAGGTTCGAGTCCTGTCGCCCCGA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna6 (303375-303464)	Length: 90 bp
Type: Ser	Anticodon: CGA at 35-37 (303409-303411)	Score: 70.62
Seq: GGTGGCGTGTCCGAGCGGCctAAGGAGAACGCCTCGAAAGCGTTTGTGGGTGCAAGCCCACCGAGGGTTCAAATCCCTCCGCCACCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>>....<<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna4 (197696-197788)	Length: 93 bp
Type: Ser	Anticodon: GCT at 37-39 (197732-197734)	Score: 71.22
Seq: GGAGGCGTCGCCTAGTCcGGTctATGGCGCCCGCCTGCTAAGCGGGTTGAGGGCAAACCCCTCtCGCGGGTTCAAATCCCGCCGCCTCCGCCA
Str: >>>>>>>..>>>.............<<<.>>>>>.......<<<<<..>.>>>....<<<.<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna45 (339731-339643)	Length: 89 bp
Type: Ser	Anticodon: GGA at 35-37 (339697-339695)	Score: 65.18
Seq: GGAGGATTCGCCTAGTGGCctATGGCGCTCGCTTGGAAAGCGGGTTGGGTTAATAGCCCtCAGGGGTTCGAATCCCCTATCCTCCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>.>....<.<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna46 (196614-196527)	Length: 88 bp
Type: Ser	Anticodon: TGA at 35-37 (196580-196578)	Score: 57.45
Seq: GGAGGGGTGCCGGAGTGGCcgATCGGAACCGCCTTGAAAGCGGTCGTAGGGAGACCTACCGCGGGTTCGAATCCCGCCCCCTCTGCCC
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.>>>>>....<<<<<.>>>>>.......<<<<<<<<<<<<....
                    
chr.trna7 (425150-425225)	Length: 76 bp
Type: Thr	Anticodon: CGT at 34-36 (425183-425185)	Score: 94.87
Seq: GCCGCCTTAGCTCAGTCGGTAGAGCGTCTCACTCGTAATGAGAAGGtCGTCGGTTCGATTCCGACAGGCGGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna9 (709261-709333)	Length: 73 bp
Type: Thr	Anticodon: GGT at 34-36 (709294-709296)	Score: 75.06
Seq: GCCCCTTTAGCTCAGTCGGCAGAGCGTCTCCATGGTAAGGAGAAGGtCTACGGTTCGATTCCGTAAAGGGGCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr.trna29 (4231514-4231439)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (4231481-4231479)	Score: 94.21
Seq: GCCGGTGTAGCTCAGTTGGTAGAGCGCCTCACTTGTAATGAGGATGtCGCGGGTTCGACTCCTGTCACCGGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna11 (733698-733773)	Length: 76 bp
Type: Trp	Anticodon: CCA at 34-36 (733731-733733)	Score: 76.65
Seq: AGGGCACTAGCTCAACTGGCAGAGCATCGGTCTCCAAAACCGAAGGtTGGGGGTTCAAGTCCCTCGTGCCCTGCAA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna8 (595077-595158)	Length: 82 bp
Type: Tyr	Anticodon: GTA at 35-37 (595111-595113)	Score: 57.50
Seq: GGCAGGTTGCCCGAGCGGCcaATGGGAGCGGACTGTAAATCCGTCGGCTTTGCCTtCGAAGGTTCGAATCCTTCACCTGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.>>>...<<<...>>>>>.......<<<<<<<<<<<<.
                    
chr.trna21 (2525215-2525289)	Length: 75 bp
Type: Val	Anticodon: CAC at 33-35 (2525247-2525249)	Score: 81.53
Seq: GGGCGATTGGCGCAGTGGTAGCGCGCTTCGTTCACACCGAAGAGGtCACTGGTTCGAACCCAGTATCGCCCACCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna37 (2523465-2523391)	Length: 75 bp
Type: Val	Anticodon: GAC at 33-35 (2523433-2523431)	Score: 89.57
Seq: GGGCGATTGGCGCAGTGGTAGCGCGCTTCCTTGACACGGAAGAGGtCACTGGTTCAAACCCAGTATCGCCCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna20 (2136462-2136536)	Length: 75 bp
Type: Val	Anticodon: TAC at 33-35 (2136494-2136496)	Score: 86.19
Seq: GGGCGTATAGCTCAGCGGTAGAGCACCTCCCTTACAAGGAGGTGGtCGGGGGTTCGATCCCCTCTGCGCCCACCC
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.