GtRNAdb

tRNAscan-SE Analysis of Arabidopsis thaliana (Feb 2004)

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr4.trna25 (13454563-13454635)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (13454596-13454598)	Score: 64.02
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGcACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna71 (6905552-6905480)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (6905519-6905517)	Score: 64.02
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGcACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna88 (17476475-17476403)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (17476442-17476440)	Score: 64.02
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGcACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna71 (13144385-13144313)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (13144352-13144350)	Score: 65.56
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna11 (2025355-2025427)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (2025388-2025390)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna13 (2334819-2334891)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (2334852-2334854)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna2 (706795-706867)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (706828-706830)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna99 (846926-846854)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (846893-846891)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna29 (10753668-10753740)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (10753701-10753703)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna75 (10760702-10760630)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (10760669-10760667)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna70 (7232865-7232793)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (7232832-7232830)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna111 (2432336-2432264)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (2432303-2432301)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna123 (150426-150354)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (150393-150391)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna30 (15993515-15993587)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (15993548-15993550)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna56 (24726892-24726964)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (24726925-24726927)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna74 (22502068-22501996)	Length: 73 bp
Type: Ala	Anticodon: AGC at 34-36 (22502035-22502033)	Score: 68.12
Seq: GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGtACGGGGATCGATACCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna27 (9598107-9598179)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (9598140-9598142)	Score: 61.16
Seq: GGGGGTGTAGCTCATATGGTAGAGCGCTCGTTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCACCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna57 (22871102-22871174)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (22871135-22871137)	Score: 64.52
Seq: GGGGATGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna164 (23936800-23936872)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (23936833-23936835)	Score: 65.14
Seq: GGGGGTGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCACCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna23 (12429609-12429681)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (12429642-12429644)	Score: 65.14
Seq: GGGGGTGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCACCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna51 (13885269-13885197)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (13885236-13885234)	Score: 65.14
Seq: GGGGGTGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCACCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna110 (2587899-2587827)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (2587866-2587864)	Score: 65.14
Seq: GGGGGTGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCACCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna53 (24547402-24547474)	Length: 73 bp
Type: Ala	Anticodon: CGC at 34-36 (24547435-24547437)	Score: 65.14
Seq: GGGGGTGTAGCTCATATGGTAGAGCGCTCGCTTCGCATGCGAGAGGcACGGGGTTCGATTCCCCGCACCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna59 (23047855-23047927)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (23047888-23047890)	Score: 63.65
Seq: GGGGATGTAGCTCATATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACAGGGTTCGATTCCCTGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna207 (20416667-20416595)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (20416634-20416632)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna22 (4741996-4742068)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (4742029-4742031)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna23 (4743092-4743164)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (4743125-4743127)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna237 (2846611-2846539)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (2846578-2846576)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna33 (9158170-9158242)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (9158203-9158205)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna59 (19351497-19351569)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (19351530-19351532)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna98 (1054787-1054715)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (1054754-1054752)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna61 (23296801-23296729)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (23296768-23296766)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna62 (23296640-23296568)	Length: 73 bp
Type: Ala	Anticodon: TGC at 34-36 (23296607-23296605)	Score: 66.31
Seq: GGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTTGCATGCGAGAGGcACGGGGTTCGATCCCCCGCATCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna80 (9472733-9472661)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (9472700-9472698)	Score: 70.96
Seq: GACTCCATGGCCCAATGGAtAAGGCGCTGGTCTACGAAACCAGAGAcTCTGGGTTCGATCCCCAGTGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna20 (4440212-4440284)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (4440245-4440247)	Score: 73.60
Seq: GACTTCATGGCCCAATGGAtAAGGCGCTGGTCTACGAAACCAGAGAtTCTGGGTTCGATCCCCAGTGAAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna55 (17880767-17880839)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (17880800-17880802)	Score: 73.60
Seq: GACTTCATGGCCCAATGGAtAAGGCGCTGGTCTACGAAACCAGAGAtTCTGGGTTCGATCCCCAGTGAAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna28 (10380656-10380728)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (10380689-10380691)	Score: 74.20
Seq: GACTCTGTGGCCCAATGGAtAAGGCGCTGGTCTACGAAACCAGAGAtTCTGGGTTCGATCCCCAGCAGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna107 (3212424-3212352)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (3212391-3212389)	Score: 74.20
Seq: GACTCTGTGGCCCAATGGAtAAGGCGCTGGTCTACGAAACCAGAGAtTCTGGGTTCGATCCCCAGCAGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna79 (7224296-7224224)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (7224263-7224261)	Score: 74.25
Seq: GGTTCCATGGCCCAATGGAtAAGGCGCTGGTCTACGAAACCAGAGAtTCTGGGTTCGATCCCCAGTGGAATCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna31 (15183090-15183162)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (15183123-15183125)	Score: 75.05
Seq: GACTCCATGGCCCAATGGAtAAGGCGCTGGTCTACGAAACCAGAGAtTCTGGGTTCGATCCCCAGTGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna44 (18501778-18501706)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (18501745-18501743)	Score: 75.05
Seq: GACTCCATGGCCCAATGGAtAAGGCGCTGGTCTACGAAACCAGAGAtTCTGGGTTCGATCCCCAGTGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna61 (25989904-25989976)	Length: 73 bp
Type: Arg	Anticodon: ACG at 34-36 (25989937-25989939)	Score: 75.45
Seq: GACTCCGTGGCCCAATGGAtAAGGCGCTGGTCTACGAAACCAGAGAtTCTGGGTTCGATCCCCAGCGGAGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna181 (29809016-29809088)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (29809049-29809051)	Score: 72.20
Seq: GACCGCGTGGCCTAATGGAtAAGGCGCTCGCCTCCGGAGCGGGAGAtTGTGGGTTCGAGTCCCACCGTGGTCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna227 (5619537-5619465)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (5619504-5619502)	Score: 72.20
Seq: GACCGCGTGGCCTAATGGAtAAGGCGCTCGCCTCCGGAGCGGGAGAtTGTGGGTTCGAGTCCCACCGTGGTCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna7 (1220235-1220307)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (1220268-1220270)	Score: 72.92
Seq: GTTTGCGTGGCCTAATGGAtAAGGCGCTCGCCTCCGAAGCGGGAGAtTGTGGGTTCGAATCCCATCGCGAACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna82 (3995176-3995104)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (3995143-3995141)	Score: 85.01
Seq: GATCCCATAGCGGAGTGGAtATCGCGTTAGACTCCGAATCTAAAGGtCGTGGGTTCGATTCCCACTGGGATCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna94 (13823284-13823212)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (13823251-13823249)	Score: 57.69
Seq: GCGCATGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAGGtCGTAGGTTTGACCCCTACCTGGCACG
Str: >.>>..>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<..<<.<.
                    
chr4.trna48 (16454773-16454701)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (16454740-16454738)	Score: 71.26
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAAGtCGAAGGTTCGACCCCTTCCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
chr5.trna12 (3324703-3324775)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (3324736-3324738)	Score: 75.77
Seq: GCGTCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAGGtCGTAGGTTCGACCCCTACCTGACGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
chr1.trna74 (18391470-18391542)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (18391503-18391505)	Score: 76.26
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAGGtCGTAGGTTCGACCCCTACCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
chr3.trna14 (3535152-3535224)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (3535185-3535187)	Score: 76.26
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAGGtCGTAGGTTCGACCCCTACCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
chr3.trna23 (6663714-6663786)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (6663747-6663749)	Score: 76.26
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAGGtCGTAGGTTCGACCCCTACCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
chr5.trna6 (1742693-1742765)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (1742726-1742728)	Score: 76.26
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAGGtCGTAGGTTCGACCCCTACCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
chr5.trna62 (26212685-26212757)	Length: 73 bp
Type: Arg	Anticodon: CCT at 34-36 (26212718-26212720)	Score: 76.26
Seq: GCGCCTGTAGCTCAGTGGAtAGAGCGTCTGTTTCCTAAGCAGAAGGtCGTAGGTTCGACCCCTACCTGGCGCG
Str: >>>>>.>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<.<<<<<.
                    
chr1.trna200 (22481511-22481438)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (22481477-22481475)	Score: 81.86
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTCTGACTTCGGATCAGAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna210 (19502161-19502088)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (19502127-19502125)	Score: 81.86
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTCTGACTTCGGATCAGAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna235 (3678848-3678775)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (3678814-3678812)	Score: 81.86
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTCTGACTTCGGATCAGAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna186 (30088962-30088889)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (30088928-30088926)	Score: 82.11
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTTTGACTTCGGATCAAAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna86 (2918492-2918419)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (2918458-2918456)	Score: 82.11
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTTTGACTTCGGATCAAAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna119 (588964-588891)	Length: 74 bp
Type: Arg	Anticodon: TCG at 35-37 (588930-588928)	Score: 82.11
Seq: GACCGCATAGCGCAGTGGAttAGCGCGTTTGACTTCGGATCAAAAGGtCGTGGGTTCGACTCCCACTGTGGTCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna5 (998941-999013)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (998974-998976)	Score: 66.87
Seq: GCACCCGTGGCCTAATGGAtAAGGCGTTTGACTTCTAATCACACGAtTGTGGGTTCGAGTCCCACCGGGTGTG
Str: >>>>>>>..>>>>........<<<<.>.>>>.......<<<.<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna56 (18576986-18577058)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (18577019-18577021)	Score: 70.42
Seq: GCACCCGTGGCCTAATGGAtAAGGCGTTTGACTTCTAATCAAGCGAtTGTGGGTTCGAGTCCCACCGGGTGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna35 (16304129-16304201)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (16304162-16304164)	Score: 71.62
Seq: GCGCTCGTGGCCCAATGGAtAAGGCGTCTGACTTCTAATCAGACGAtTGTGGGTTCGATCCCCACCGAGCGTG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna30 (15120656-15120728)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (15120689-15120691)	Score: 73.37
Seq: GCACCCATGGCCTAATGGAtAAGGCGCTTGACTTCTAATCAAGCGAtTGTGGGTTCGAGTCCCACTGGGTGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna32 (15576656-15576728)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (15576689-15576691)	Score: 73.37
Seq: GCACCCATGGCCTAATGGAtAAGGCGCTTGACTTCTAATCAAGCGAtTGTGGGTTCGAGTCCCACTGGGTGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna13 (3096221-3096293)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (3096254-3096256)	Score: 73.39
Seq: GCACCCGTGGCCTAATGGAtAAGGCGTTTGACTTCTAATCAAACGAtTGTGGGTTCGAGTCCCACCGGGTGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna64 (13687638-13687710)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (13687671-13687673)	Score: 73.62
Seq: GCGCCCGTGGCCTAATGGAtAAGGCGTTTGACTTCTAATCAAACGAtTGTGGGTTCGAGTCCCACCGGGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna51 (15353239-15353311)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (15353272-15353274)	Score: 73.62
Seq: GCGCCCGTGGCCTAATGGAtAAGGCGTTTGACTTCTAATCAAACGAtTGTGGGTTCGAGTCCCACCGGGCGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna29 (10820918-10820990)	Length: 73 bp
Type: Arg	Anticodon: TCT at 34-36 (10820951-10820953)	Score: 75.03
Seq: GCACCCATGGCCTAATGGAtAAGGCGCTTGACTTCTAATCAAGCGAtTGTGGGTTCGAATCCCACTGGGTGTG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna34 (13658351-13658425)	Length: 75 bp
Type: Asn	Anticodon: GTT at 36-38 (13658386-13658388)	Score: 72.51
Seq: GCTGGAATAGCTCAGTAGGTttAGAGCGTGTGGCTGTTAACCTCAAGGtCGGAGGTTCGACCCCTCCTTTCAGCG
Str: >>>>>>>..>>>>..........<<<<.>>.>>.......<<.<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna230 (5189755-5189682)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (5189721-5189719)	Score: 73.38
Seq: GCTGGAATAGCTCAGATGGCtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCAAGCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna18 (3496437-3496508)	Length: 72 bp
Type: Asn	Anticodon: GTT at 33-35 (3496469-3496471)	Score: 77.17
Seq: TCCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACTGATTGGtCGTAGGTTCAAATCCTACTTGGGGAG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna69 (7341494-7341421)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (7341460-7341458)	Score: 78.40
Seq: GCTGGAGTAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCAGAGGTTCGACCCCTTTCTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna77 (19428224-19428297)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (19428258-19428260)	Score: 80.57
Seq: GCTGGAGTAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCAGAGGTTCGACCCCTCTCTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna86 (7962832-7962759)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (7962798-7962796)	Score: 80.57
Seq: GCTGGAGTAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCAGAGGTTCGACCCCTCTCTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna20 (11910300-11910373)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (11910334-11910336)	Score: 80.57
Seq: GCTGGAGTAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCAGAGGTTCGACCCCTCTCTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna67 (26573322-26573249)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (26573288-26573286)	Score: 80.57
Seq: GCTGGAGTAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCAGAGGTTCGACCCCTCTCTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna170 (26053141-26053214)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (26053175-26053177)	Score: 82.29
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCGACCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna1 (102064-102137)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (102098-102100)	Score: 82.29
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCGACCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna48 (15175941-15176014)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (15175975-15175977)	Score: 82.29
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCGACCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna42 (18928414-18928487)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (18928448-18928450)	Score: 82.29
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCGACCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna68 (26238933-26238860)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (26238899-26238897)	Score: 82.29
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCGACCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna93 (15049811-15049738)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (15049777-15049775)	Score: 82.29
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCGACCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna242 (1583844-1583771)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (1583810-1583808)	Score: 82.78
Seq: GCTGGAATAGCTCAGCTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCGAACCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna32 (9143797-9143870)	Length: 74 bp
Type: Asn	Anticodon: GTT at 35-37 (9143831-9143833)	Score: 84.99
Seq: GCTGGAATAGCTCAGTTGGTtAGAGCGTGTGGCTGTTAACCACAAGGtCGGAGGTTCGATCCCTCCTTCTAGCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna94 (3255902-3255829)	Length: 74 bp
Type: Asp	Anticodon: GTC at 35-37 (3255868-3255866)	Score: 60.73
Seq: GGGATTGTAGTTCAATCGGTcAGAGCACCGCCCTGTCAAGGCGGAAGcTGCGGGTTCGAGCCCCGTCAGTCCCG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna27 (11802285-11802356)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (11802318-11802320)	Score: 61.39
Seq: GTCGTTATAGTATAGTGGTaAGTATTCCCGCCTGTCATGCGGGTGACCCGGGTTCAATCCCCGGCAACGGCG
Str: >>>>>>...>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<.<<<<<<.
                    
chr1.trna213 (16588216-16588145)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (16588183-16588181)	Score: 63.92
Seq: GTCGTTGTAGTATAGTGGTaAGGATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCTCGGCAACGACG
Str: >>>>>>>..>>.>........<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna35 (14250207-14250278)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (14250240-14250242)	Score: 64.11
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAAAGGCG
Str: >>>.>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<.<<<.
                    
chr1.trna174 (27792644-27792715)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (27792677-27792679)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna176 (28188193-28188264)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (28188226-28188228)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna179 (28531428-28531499)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (28531461-28531463)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna212 (18139337-18139266)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (18139304-18139302)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna26 (6075813-6075884)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (6075846-6075848)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna27 (6345757-6345828)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (6345790-6345792)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna5 (877649-877720)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (877682-877684)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna36 (14251775-14251846)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (14251808-14251810)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna64 (16646929-16646858)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (16646896-16646894)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna18 (4330779-4330850)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (4330812-4330814)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna26 (10211565-10211636)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (10211598-10211600)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna3 (476809-476880)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (476842-476844)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna44 (19566014-19566085)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (19566047-19566049)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna66 (22149895-22149824)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (22149862-22149860)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna70 (19044443-19044372)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (19044410-19044408)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna16 (4673903-4673974)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (4673936-4673938)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna19 (5161515-5161586)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (5161548-5161550)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna49 (23861432-23861503)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (23861465-23861467)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna7 (1788652-1788723)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (1788685-1788687)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna91 (16256937-16256866)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (16256904-16256902)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna97 (7222131-7222060)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (7222098-7222096)	Score: 69.46
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna29 (7004505-7004576)	Length: 72 bp
Type: Asp	Anticodon: GTC at 34-36 (7004538-7004540)	Score: 71.35
Seq: GTCGTTGTAGTATAGTGGTaAGTATTCCCGCCTGTCACGCGGGTGGCCCGGGTTCGATCCCCGGCAACGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna17 (3495439-3495509)	Length: 71 bp
Type: Cys	Anticodon: GCA at 33-35 (3495471-3495473)	Score: 42.92
Seq: GGCTAGGTAACATAATGGAAATGTATCGGACTGCAAATCCTGTAATGACGGTTCGACTCCGTCCTTGGCCT
Str: >>>>>>>..>>>>.......<<<<.>.>>>.......<<<.<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna99 (7074429-7074358)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (7074397-7074395)	Score: 59.44
Seq: AGGTCCATAGCTCAGTGGTAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTTGAACCTGGTTGGGCCCT
Str: .>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<..
                    
chr5.trna98 (7074845-7074774)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (7074813-7074811)	Score: 64.57
Seq: AGGTCCATAGCTCAGTGGTAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTCGAACCCGATTGGGCCCT
Str: .>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<..
                    
chr4.trna65 (9978189-9978118)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (9978157-9978155)	Score: 71.20
Seq: GGGTCCATAGCTCAGTGATAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna100 (7074016-7073945)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (7073984-7073982)	Score: 71.20
Seq: GGGTCCATAGCTCAGTGATAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna90 (16524832-16524761)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (16524800-16524798)	Score: 73.07
Seq: GGGCCCATAGCTCAGTGGTAGAGCATTCGACTGCAGATCGAGAGGtCACCGGTTCGAACCCGGTTGAGCCCT
Str: >>>>.>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr5.trna101 (7073603-7073532)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (7073571-7073569)	Score: 76.48
Seq: GGGTTCATAGCTCAGTGGTAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna198 (23562921-23562850)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (23562889-23562887)	Score: 76.97
Seq: GGGCTCATAGCTCAGTGGTAGAGCATTCGACTGCAGATCGAGAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna53 (16525847-16525918)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (16525879-16525881)	Score: 77.51
Seq: GAGCCTATAGCTCAGTGGTAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTCGAATCCGGTTGGGCTCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna65 (16525713-16525642)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (16525681-16525679)	Score: 77.51
Seq: GAGCCTATAGCTCAGTGGTAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTCGAATCCGGTTGGGCTCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna19 (4998148-4998219)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (4998180-4998182)	Score: 77.60
Seq: GGGTCCTTAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTAGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna68 (19420417-19420346)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (19420385-19420383)	Score: 78.18
Seq: GGGTCCATAGCTCAGTGGTAGAGCATTTGACTGCAGATCAAGAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna36 (18924750-18924821)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (18924782-18924784)	Score: 79.11
Seq: GGGTCCATAGCTCAGTGGTAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTCGAACCCGGTTGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna208 (19929578-19929507)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (19929546-19929544)	Score: 79.91
Seq: GGGTCCTTAGCTCAGTGGTAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTCGAATCCGGTAGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna30 (12336080-12336151)	Length: 72 bp
Type: Cys	Anticodon: GCA at 33-35 (12336112-12336114)	Score: 79.91
Seq: GGGTCCTTAGCTCAGTGGTAGAGCAATTGACTGCAGATCAATAGGtCACCGGTTCGAATCCGGTAGGGCCCT
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna21 (7046176-7046247)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (7046209-7046211)	Score: 69.59
Seq: GGTTCTATGGTCTAGCGGTtAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAATTCTCGGTAGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna82 (9277814-9277743)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (9277781-9277779)	Score: 69.59
Seq: GGTTCTATGGTCTAGCGGTtAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAATTCTCGGTAGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna52 (13882994-13882923)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (13882961-13882959)	Score: 69.59
Seq: GGTTCTATGGTCTAGCGGTtAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAATTCTCGGTAGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna79 (424788-424717)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (424755-424753)	Score: 69.59
Seq: GGTTCTATGGTCTAGCGGTtAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAATTCTCGGTAGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna58 (22892782-22892853)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (22892815-22892817)	Score: 69.79
Seq: GGTTCCATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAGTCTCGGTGGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna6 (892514-892585)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (892547-892549)	Score: 70.28
Seq: GGTCCCATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAGTCTCGGTGGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna24 (7387891-7387962)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (7387924-7387926)	Score: 70.28
Seq: GGTCCCATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAGTCTCGGTGGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna5 (1501606-1501677)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (1501639-1501641)	Score: 70.67
Seq: GGTCCTATGGTCTAGTGGTcAGGACATTGGACTCTGAATCCAGTAACCCGAGTTCAAATCTCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna245 (111961-111890)	Length: 72 bp
Type: Gln	Anticodon: CTG at 34-36 (111928-111926)	Score: 72.52
Seq: GGTTCCATGGTCTAGCGGTtAGGACACTAGACTCTGAATCTAGTAACCCGAGTTCAAGTCTCGGTGGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna5 (3276437-3276508)	Length: 72 bp
Type: Gln	Anticodon: TTG at 33-35 (3276469-3276471)	Score: 54.44
Seq: TGGAGTATAGCCAAGTGGTAAGGCACCGGTTTTTGGTACCGGCATGCAAAGGTTCGAATCCTTTTACTCCAG
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna25 (7981401-7981472)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (7981434-7981436)	Score: 73.55
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCAGGACTTTGAATCCTGCGACCTGGGTTCGACTCCCGGTAGAACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna188 (29148055-29147984)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (29148022-29148020)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna190 (28952519-28952448)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (28952486-28952484)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna221 (7656180-7656109)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (7656147-7656145)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna222 (7499793-7499722)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (7499760-7499758)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna38 (18080063-18080134)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (18080096-18080098)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna40 (20692448-20692519)	Length: 72 bp
Type: Gln	Anticodon: TTG at 34-36 (20692481-20692483)	Score: 74.09
Seq: GGTTCTATGGTGTAGTGGTtAGCACTCTGGACTTTGAATCCAGCGACCTGGGTTCGACTCCCGGTAGGACCT
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna19 (10302012-10302084)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (10302046-10302048)	Score: 70.56
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCAAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>.>>.......<<.<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna177 (28411645-28411717)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (28411679-28411681)	Score: 76.51
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna192 (28377222-28377150)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (28377188-28377186)	Score: 76.51
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna218 (10207364-10207292)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (10207330-10207328)	Score: 76.51
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna61 (10756704-10756776)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (10756738-10756740)	Score: 76.51
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna58 (18963714-18963786)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (18963748-18963750)	Score: 76.51
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna55 (22786897-22786969)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (22786931-22786933)	Score: 76.51
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna36 (16556628-16556700)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (16556662-16556664)	Score: 76.51
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna38 (17130055-17130127)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (17130089-17130091)	Score: 76.51
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna108 (3030890-3030818)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (3030856-3030854)	Score: 76.51
Seq: TCCGTTGTAGTCTAGCTGGTcAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna52 (15923895-15923967)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (15923929-15923931)	Score: 78.60
Seq: TCCGTTGTAGTCTAGCTGGTtAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCAACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna71 (19008694-19008622)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (19008660-19008658)	Score: 79.86
Seq: TCCGTCGTAGTCTAGCTGGTtAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCGACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna12 (7814198-7814270)	Length: 73 bp
Type: Glu	Anticodon: CTC at 35-37 (7814232-7814234)	Score: 79.86
Seq: TCCGTCGTAGTCTAGCTGGTtAGGATACTCGGCTCTCACCCGAGAGACCCGGGTTCGAGTCCCGGCGACGGAG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna77 (611932-611866)	Length: 67 bp
Type: Glu	Anticodon: TTC at 32-34 (611901-611899)	Score: 24.19
Seq: CTTAAACACTCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCCATTCCCGGTAACG
Str: .>>>...>.>>........<<.<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<..
                    
chr2.trna93 (3303312-3303241)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (3303279-3303277)	Score: 65.98
Seq: GTCCCTTTCGTCCAGTGGTtAGGACATCGTCTTTTCATGTCGAAGACACGGGTTCGATTCCCGTAAGGGATA
Str: >>>>>>>..>>>>........<<<<.>>>.>.......<.<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna191 (28523717-28523646)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (28523684-28523682)	Score: 71.73
Seq: TCCGTTATCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGTAACGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna72 (18755860-18755789)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (18755827-18755825)	Score: 71.73
Seq: TCCGTTATCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGTAACGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna17 (2939419-2939490)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (2939452-2939454)	Score: 72.05
Seq: TCCGATGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCATCGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna224 (6995344-6995273)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (6995311-6995309)	Score: 72.05
Seq: TCCGATGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCATCGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna46 (17500872-17500801)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (17500839-17500837)	Score: 72.05
Seq: TCCGATGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCATCGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna66 (26670567-26670496)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (26670534-26670532)	Score: 72.05
Seq: TCCGATGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCATCGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna84 (18560278-18560207)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (18560245-18560243)	Score: 72.05
Seq: TCCGATGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCATCGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna95 (9815477-9815406)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (9815444-9815442)	Score: 72.05
Seq: TCCGATGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCATCGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna93 (1601415-1601344)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (1601382-1601380)	Score: 72.13
Seq: TCCGTTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAACGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna40 (18837021-18837092)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (18837054-18837056)	Score: 72.20
Seq: TCCATTGTCGTCCAGCGGTtAGGATATCTGGCTTTCACCCAGGAGACCCGGGTTCGATTCCCGGCAATGGAG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna215 (12097327-12097259)	Length: 69 bp
Type: Gly	Anticodon: ACC at 33-35 (12097295-12097293)	Score: 20.99
Seq: GCACCAATGGTTCAGTGGTAGATTAATACTCTACCACTATCTAACCCGGGTTCGATCCCAGACGGTGTA
Str: >>>>>....>.>>.......<<.<.>.>...........<.<...>.>>>......<<<.<..<<<<<.
                    
chr2.trna60 (19566995-19566925)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (19566963-19566961)	Score: 68.50
Seq: GCGCATCTGGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCAGGGTTCGATTCCCTGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna60 (23221683-23221753)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (23221715-23221717)	Score: 68.50
Seq: GCGCATCTGGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCAGGGTTCGATTCCCTGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna59 (12486282-12486212)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (12486250-12486248)	Score: 68.50
Seq: GCGCATCTGGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCAGGGTTCGATTCCCTGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna6 (6646426-6646496)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (6646458-6646460)	Score: 68.50
Seq: GCGCATCTGGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCAGGGTTCGATTCCCTGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna78 (21740410-21740340)	Length: 71 bp
Type: Gly	Anticodon: CCC at 33-35 (21740378-21740376)	Score: 68.50
Seq: GCGCATCTGGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCAGGGTTCGATTCCCTGGATGCGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna7 (1159022-1159092)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (1159054-1159056)	Score: 57.43
Seq: TAACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: ..>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<...
                    
chr2.trna88 (3444431-3444360)	Length: 72 bp
Type: Gly	Anticodon: GCC at 33-35 (3444399-3444397)	Score: 62.60
Seq: GCGGAAATAGCTTAATGGTAGAGCATAGCCTTGCCAAGGCTAAGGtTGAGGGTTCAAGTCCCTCCTTCCGCT
Str: >>>>>>...>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<.<<<<<<.
                    
chr3.trna91 (1843400-1843330)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (1843368-1843366)	Score: 65.04
Seq: GCACCAGTGGTCTAGTGGTAGAATAGAACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>.>>>.......<<<.<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna122 (389960-389890)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (389928-389926)	Score: 66.11
Seq: GCACCAGTGGTCTAGTGGCATGATAGTACCCTGCCACGGTACATACCCGGGTTCAATTCCCGGCTGGTGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna201 (22401327-22401257)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (22401295-22401293)	Score: 67.59
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACTCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna161 (22431832-22431902)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (22431864-22431866)	Score: 69.82
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCAATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna54 (17667856-17667926)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (17667888-17667890)	Score: 69.82
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCAATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna171 (26977051-26977121)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (26977083-26977085)	Score: 70.74
Seq: GCACCAGTGGTCTAGTGGCATGATAGTACCCTGCCACGGTACAGACCCGGGTTCAATTCCCGGCTGGTGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna87 (17512839-17512769)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (17512807-17512805)	Score: 70.74
Seq: GCACCAGTGGTCTAGTGGCATGATAGTACCCTGCCACGGTACAGACCCGGGTTCAATTCCCGGCTGGTGCA
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna202 (22398372-22398302)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (22398340-22398338)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna203 (22317149-22317079)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (22317117-22317115)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna240 (2111217-2111147)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (2111185-2111183)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna241 (2107467-2107397)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (2107435-2107433)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna32 (12888668-12888738)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (12888700-12888702)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna33 (12889811-12889881)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (12889843-12889845)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna72 (12983095-12983025)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (12983063-12983061)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna47 (19995919-19995989)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (19995951-19995953)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna51 (21553259-21553329)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (21553291-21553293)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna56 (22853497-22853567)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (22853529-22853531)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna33 (15671399-15671469)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (15671431-15671433)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna113 (2212749-2212679)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (2212717-2212715)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna23 (6401241-6401311)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (6401273-6401275)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna65 (26700004-26699934)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (26699972-26699970)	Score: 71.56
Seq: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA
Str: >>>>>>>..>>.>.......<.<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna14 (2588522-2588593)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (2588555-2588557)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna232 (4285956-4285885)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (4285923-4285921)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna74 (12478921-12478850)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (12478888-12478886)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna75 (11871302-11871231)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (11871269-11871267)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna35 (17160737-17160808)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (17160770-17160772)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna74 (16438097-16438026)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (16438064-16438062)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna63 (10326047-10325976)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (10326014-10326012)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna105 (3578367-3578296)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (3578334-3578332)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna13 (3617059-3617130)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (3617092-3617094)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna34 (18576072-18576143)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (18576105-18576107)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna50 (23971168-23971239)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (23971201-23971203)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna51 (23974656-23974727)	Length: 72 bp
Type: Gly	Anticodon: TCC at 34-36 (23974689-23974691)	Score: 75.78
Seq: GCGTCTGTAGTCCAACGGTtAGGATAATTGCCTTCCAAGCAATAGACCCGGGTTCGACTCCCGGCAGACGCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna2 (901176-901247)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (901209-901211)	Score: 57.37
Seq: GTGGTTGTAGTATAGCGGTtAGTATCCCACGTTGTGGCCGTGGGGACCCGGGCTCGAATCCCGGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna239 (2406902-2406831)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (2406869-2406867)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna3 (552640-552711)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (552673-552675)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna89 (2105033-2104962)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (2105000-2104998)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna40 (18293774-18293845)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (18293807-18293809)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna120 (559399-559328)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (559366-559364)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna39 (20064049-20064120)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (20064082-20064084)	Score: 62.38
Seq: GTGGCTGTAGTTTAGTGGTaAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna31 (12346828-12346899)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (12346861-12346863)	Score: 62.41
Seq: GTGGCTGTAGTTTAGTGGTtAGAATCCCACGTTGTGGCCGTGGGGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna13 (8255696-8255767)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (8255729-8255731)	Score: 62.41
Seq: GTGGCTGTAGTTTAGTGGTtAGAATCCCACGTTGTGGCCGTGGGGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna71 (25892691-25892620)	Length: 72 bp
Type: His	Anticodon: GTG at 34-36 (25892658-25892656)	Score: 67.27
Seq: GTGGCTGTAGTTTAGTGGTtAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGCCACA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna7 (3290963-3291034)	Length: 72 bp
Type: Ile	Anticodon: AAT at 35-37 (3290997-3290999)	Score: 42.87
Seq: GCATCCATGGCTGAATGGTtAAAGCGcCCAACCTAATAAAGAGGCAAGTAGGTTCGATTCCTGCTGGATGCA
Str: >>>>>>>..>>>..........<<<..>>.............<<...>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna95 (3239725-3239654)	Length: 72 bp
Type: Ile	Anticodon: AAT at 35-37 (3239691-3239689)	Score: 42.87
Seq: GCATCCATGGCTGAATGGTtAAAGCGcCCAACCTAATAAAGAGGCAAGTAGGTTCGATTCCTGCTGGATGCA
Str: >>>>>>>..>>>..........<<<..>>.............<<...>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna169 (25993393-25993466)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (25993427-25993429)	Score: 83.92
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCACAGGTTCGATCCCTGTATAGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna62 (11104094-11104167)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (11104128-11104130)	Score: 83.92
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCACAGGTTCGATCCCTGTATAGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna26 (9509360-9509433)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (9509394-9509396)	Score: 83.92
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCACAGGTTCGATCCCTGTATAGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna81 (9456962-9456889)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (9456928-9456926)	Score: 83.92
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCACAGGTTCGATCCCTGTATAGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna76 (9373684-9373611)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (9373650-9373648)	Score: 83.92
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCACAGGTTCGATCCCTGTATAGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna53 (13341575-13341502)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (13341541-13341539)	Score: 83.92
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCACAGGTTCGATCCCTGTATAGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna54 (13336419-13336346)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (13336385-13336383)	Score: 83.92
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCACAGGTTCGATCCCTGTATAGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna18 (5157642-5157715)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (5157676-5157678)	Score: 83.92
Seq: GGCCTATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCACAGGTTCGATCCCTGTATAGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna10 (1978083-1978156)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (1978117-1978119)	Score: 86.52
Seq: GGCCCATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna166 (25890199-25890272)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (25890233-25890235)	Score: 86.52
Seq: GGCCCATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna231 (4522779-4522706)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (4522745-4522743)	Score: 86.52
Seq: GGCCCATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna22 (7749794-7749867)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (7749828-7749830)	Score: 86.52
Seq: GGCCCATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna2 (469667-469740)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (469701-469703)	Score: 86.52
Seq: GGCCCATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna43 (18542165-18542238)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (18542199-18542201)	Score: 86.52
Seq: GGCCCATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna29 (15593087-15593160)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (15593121-15593123)	Score: 86.52
Seq: GGCCCATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna45 (22845357-22845430)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (22845391-22845393)	Score: 86.52
Seq: GGCCCATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna63 (26585623-26585696)	Length: 74 bp
Type: Ile	Anticodon: AAT at 35-37 (26585657-26585659)	Score: 86.52
Seq: GGCCCATTAGCTCAGTTGGTtAGAGCGTCGTGCTAATAACGCGAAGGtCGCAGGTTCGAAACCTGCATGGGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna8 (1738797-1738870)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (1738831-1738833)	Score: 81.06
Seq: GCTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGAAGCA
Str: >>>.>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chr1.trna12 (2177884-2177957)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (2177918-2177920)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna78 (19851641-19851714)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (19851675-19851677)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna81 (5068374-5068301)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (5068340-5068338)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna47 (17276779-17276706)	Length: 74 bp
Type: Ile	Anticodon: TAT at 35-37 (17276745-17276743)	Score: 85.40
Seq: GGTCCCGTAGCTCAGTTGGTtAGAGCGTTGGTCTTATGAGCCGAAGGtCGCGGGTTCGAGCCCCGCCGGGACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna66 (17159800-17159871)	Length: 72 bp
Type: Leu	Anticodon: AAG at 33-35 (17159832-17159834)	Score: 55.79
Seq: GGGCATTTGGTCTAGTGGTTTGATTTTCGCTTAAGGTGCGAGAGGtCCCGAGTTCAATTCTCAGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr5.trna52 (24279806-24279886)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (24279841-24279843)	Score: 66.01
Seq: GTTGATATGGCCGAGTTGGTccAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna193 (28024124-28024044)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (28024089-28024087)	Score: 68.09
Seq: GTTGATATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna77 (11122837-11122757)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (11122802-11122800)	Score: 68.09
Seq: GTTGATATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna83 (9273969-9273889)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (9273934-9273932)	Score: 68.09
Seq: GTTGATATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna17 (4254535-4254615)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (4254570-4254572)	Score: 68.09
Seq: GTTGATATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna54 (22622385-22622465)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (22622420-22622422)	Score: 68.09
Seq: GTTGATATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna11 (7730957-7731037)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (7730992-7730994)	Score: 68.09
Seq: GTTGATATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna11 (3118378-3118458)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (3118413-3118415)	Score: 68.09
Seq: GTTGATATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna116 (970878-970798)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (970843-970841)	Score: 68.09
Seq: GTTGATATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna31 (16427813-16427893)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (16427848-16427850)	Score: 68.09
Seq: GTTGATATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna60 (25942292-25942372)	Length: 81 bp
Type: Leu	Anticodon: AAG at 36-38 (25942327-25942329)	Score: 68.09
Seq: GTTGATATGGCCGAGTTGGTctAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTGTCAACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna109 (2898951-2898868)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (2898917-2898915)	Score: 69.94
Seq: GTCAGGTTGGCCGAGTGGTctAAGGCGCCAGACTCAAGTTCTGGTCTTCGAGAGAGGGCGTGGGTTCAAATCCCACATCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna9 (2411149-2411232)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (2411183-2411185)	Score: 69.94
Seq: GTCAGGTTGGCCGAGTGGTctAAGGCGCCAGACTCAAGTTCTGGTCTTCGAGAGAGGGCGTGGGTTCAAATCCCACATCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna163 (23806216-23806299)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (23806250-23806252)	Score: 70.82
Seq: GTCAGGATGGCCGAGTGGTctAAGGCGCCAGACTCAAGTTCTGGTCTTCGAAAGAGGGCGTGGGTTCAAATCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna22 (12320120-12320203)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (12320154-12320156)	Score: 72.13
Seq: GTCAGGGTGGCCGAGTGGTctAAGGCGCCAGACTCAAGTTCTGGTCCTCGTAAGAGGGCGTGGGTTCAAATCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna26 (8906419-8906502)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (8906453-8906455)	Score: 72.13
Seq: GTCAGGGTGGCCGAGTGGTctAAGGCGCCAGACTCAAGTTCTGGTCCTCGTAAGAGGGCGTGGGTTCAAATCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna79 (21318189-21318106)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (21318155-21318153)	Score: 72.13
Seq: GTCAGGGTGGCCGAGTGGTctAAGGCGCCAGACTCAAGTTCTGGTCCTCGTAAGAGGGCGTGGGTTCAAATCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna56 (13076666-13076583)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (13076632-13076630)	Score: 72.24
Seq: GTCAGGATGGCCGAGTGGTctAAGGCGCCAGACTCAAGTTCTGGTCTTCGTAAGAGGGCGTGGGTTCAAACCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna225 (6948934-6948851)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (6948900-6948898)	Score: 73.97
Seq: GTCAGGATGGCCGAGTGGTctAAGGCGCCAGACTCAAGTTCTGGTCCTCGTAAGAGGGCGTGGGTTCAAACCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna72 (6837853-6837770)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (6837819-6837817)	Score: 73.97
Seq: GTCAGGATGGCCGAGTGGTctAAGGCGCCAGACTCAAGTTCTGGTCCTCGTAAGAGGGCGTGGGTTCAAACCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna32 (16655394-16655477)	Length: 84 bp
Type: Leu	Anticodon: CAA at 35-37 (16655428-16655430)	Score: 73.97
Seq: GTCAGGATGGCCGAGTGGTctAAGGCGCCAGACTCAAGTTCTGGTCCTCGTAAGAGGGCGTGGGTTCAAACCCCACTTCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna175 (28031621-28031701)	Length: 81 bp
Type: Leu	Anticodon: CAG at 36-38 (28031656-28031658)	Score: 68.96
Seq: GTCAAGATGGCCGAGTTGGTctAAGGCGCCAGTTTCAGGTACTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTTGACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna28 (6488646-6488726)	Length: 81 bp
Type: Leu	Anticodon: CAG at 36-38 (6488681-6488683)	Score: 68.96
Seq: GTCAAGATGGCCGAGTTGGTctAAGGCGCCAGTTTCAGGTACTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTTGACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna18 (9289707-9289787)	Length: 81 bp
Type: Leu	Anticodon: CAG at 36-38 (9289742-9289744)	Score: 68.96
Seq: GTCAAGATGGCCGAGTTGGTctAAGGCGCCAGTTTCAGGTACTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTTGACA
Str: >>>>>>>..>>>............<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna24 (9291114-9291185)	Length: 72 bp
Type: Leu	Anticodon: GAG at 34-36 (9291147-9291149)	Score: 49.78
Seq: GTGGCTGTAATACAGTGGTtAGTATTCTACGTTGAGGCCGAAGGGACCTGGGCTCGATTCCCAGCAGACACA
Str: >>>.>>>..>>>>........<<<<.>>.>>.......<<.<<....>>>>>.......<<<<<<<<.<<<.
                    
chr3.trna12 (3090549-3090631)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (3090582-3090584)	Score: 63.86
Seq: GCAGGTTTGCCCGAGAGGTtAAGGGGGAAGACTTAAGTTCTTCTGCACATAAGTGCGCGTGGGTTCGAACCCCACAGCCTGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna45 (19648106-19648188)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (19648139-19648141)	Score: 63.86
Seq: GCAGGTTTGCCCGAGAGGTtAAGGGGGAAGACTTAAGTTCTTCTGCACATAAGTGCGCGTGGGTTCGAACCCCACAGCCTGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna50 (15327313-15327395)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (15327346-15327348)	Score: 68.40
Seq: GCAGGTTTGCCCGAGTGGTtAAGGGGGAAGACTTAAGTTCTTCTGCACATAAGTGCGCGTGGGTTCGAACCCCACAGCCTGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna67 (15327546-15327464)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (15327513-15327511)	Score: 68.40
Seq: GCAGGTTTGCCCGAGTGGTtAAGGGGGAAGACTTAAGTTCTTCTGCACATAAGTGCGCGTGGGTTCGAACCCCACAGCCTGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna4 (984366-984448)	Length: 83 bp
Type: Leu	Anticodon: TAA at 34-36 (984399-984401)	Score: 68.40
Seq: GCAGGTTTGCCCGAGTGGTtAAGGGGGAAGACTTAAGTTCTTCTGCACATAAGTGCGCGTGGGTTCGAACCCCACAGCCTGCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna73 (6837639-6837556)	Length: 84 bp
Type: Leu	Anticodon: TAA at 35-37 (6837605-6837603)	Score: 74.53
Seq: GTCAGTATGGCCGAGTGGTctAAGGCGCCAGACTTAAGTTCTGGTCCTCTTACGAGGGCGTGGGTTCAAACCCCACTGCTGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>....<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna74 (5268210-5268125)	Length: 86 bp
Type: Leu	Anticodon: TAG at 35-37 (5268176-5268174)	Score: 41.09
Seq: GCCGCTATGGTGAAATTGGTAgACACGCTGCTCTTAGGAAGCAGTGCTAGAGCATCTCGGTTCGAGTtcgagtCCGAGTAGCGGCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>..<<<..>>>>>.............<<<<<<<<<<<<.
                    
chr1.trna75 (18556667-18556746)	Length: 80 bp
Type: Leu	Anticodon: TAG at 35-37 (18556701-18556703)	Score: 63.97
Seq: GATAGTTTGGCCGAGTGGTctAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACAGCTGTCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna76 (18561568-18561647)	Length: 80 bp
Type: Leu	Anticodon: TAG at 35-37 (18561602-18561604)	Score: 63.97
Seq: GATAGTTTGGCCGAGTGGTctAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACAGCTGTCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna162 (22890755-22890834)	Length: 80 bp
Type: Leu	Anticodon: TAG at 35-37 (22890789-22890791)	Score: 68.10
Seq: GACAATTTGGCCGAGTGGTctAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACAGTTGTCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna49 (15176657-15176736)	Length: 80 bp
Type: Leu	Anticodon: TAG at 35-37 (15176691-15176693)	Score: 68.10
Seq: GACAATTTGGCCGAGTGGTctAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACAGTTGTCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna64 (10093157-10093078)	Length: 80 bp
Type: Leu	Anticodon: TAG at 35-37 (10093123-10093121)	Score: 68.10
Seq: GACAATTTGGCCGAGTGGTctAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACAGTTGTCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna19 (3881529-3881608)	Length: 80 bp
Type: Leu	Anticodon: TAG at 35-37 (3881563-3881565)	Score: 68.72
Seq: GACAGTTTGGCCGAGTGGTctAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACAGCTGTCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna43 (19511966-19512045)	Length: 80 bp
Type: Leu	Anticodon: TAG at 35-37 (19512000-19512002)	Score: 68.72
Seq: GACAGTTTGGCCGAGTGGTctAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACAGCTGTCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna115 (1853382-1853303)	Length: 80 bp
Type: Leu	Anticodon: TAG at 35-37 (1853348-1853346)	Score: 68.72
Seq: GACAGTTTGGCCGAGTGGTctAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACAGCTGTCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna35 (18807535-18807614)	Length: 80 bp
Type: Leu	Anticodon: TAG at 35-37 (18807569-18807571)	Score: 68.72
Seq: GACAGTTTGGCCGAGTGGTctAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACAGCTGTCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>....<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna21 (11974952-11975032)	Length: 81 bp
Type: Lys	Anticodon: CTT at 34-36 (11974985-11974987)	Score: 33.91
Seq: CATCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACTTTGTGGACTTGTGGtCATTGGTTCGAGTTACATGGTGGGCG
Str: ..>>>>>..>>>>........<<<<.>>>>>.......<<<<<...>>..<<....>>..>.......<..<<<<<<<...
                    
chr4.trna58 (13006316-13006244)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (13006283-13006281)	Score: 77.71
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTCTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna228 (5518128-5518056)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (5518095-5518093)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna244 (309347-309275)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (309314-309312)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna30 (7016507-7016579)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (7016540-7016542)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna4 (604402-604474)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (604435-604437)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna72 (17735510-17735582)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (17735543-17735545)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna57 (18710752-18710824)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (18710785-18710787)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna31 (11961646-11961718)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (11961679-11961681)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna64 (22481288-22481216)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (22481255-22481253)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna67 (20824568-20824496)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (20824535-20824533)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna1 (33800-33872)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (33833-33835)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna10 (7256409-7256481)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (7256442-7256444)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna14 (8979657-8979729)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (8979690-8979692)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna60 (11954824-11954752)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (11954791-11954789)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna121 (508500-508428)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (508467-508465)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna15 (4530476-4530548)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (4530509-4530511)	Score: 84.38
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAGCCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna21 (5632858-5632930)	Length: 73 bp
Type: Lys	Anticodon: CTT at 34-36 (5632891-5632893)	Score: 86.03
Seq: GCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGtCGTGGGTTCGAACCCCACGGTGGGCG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna10 (2285608-2285679)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (2285640-2285642)	Score: 81.97
Seq: GCCGTCTTAGCTCAGCGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna37 (19658829-19658900)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (19658861-19658863)	Score: 83.16
Seq: GCCTTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGtCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>.>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chr4.trna27 (14032496-14032567)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (14032528-14032530)	Score: 84.12
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTACCCACGAGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna182 (29838010-29838081)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (29838042-29838044)	Score: 84.42
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna183 (29838611-29838682)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (29838643-29838645)	Score: 84.42
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna76 (11782000-11781929)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (11781968-11781966)	Score: 84.42
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna16 (3942013-3942084)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (3942045-3942047)	Score: 84.42
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna46 (19935355-19935426)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (19935387-19935389)	Score: 84.42
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna14 (4471051-4471122)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (4471083-4471085)	Score: 84.42
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna42 (21418370-21418441)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (21418402-21418404)	Score: 84.42
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna55 (24684508-24684579)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (24684540-24684542)	Score: 84.42
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna82 (19761472-19761401)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (19761440-19761438)	Score: 84.42
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna86 (17856883-17856812)	Length: 72 bp
Type: Lys	Anticodon: TTT at 33-35 (17856851-17856849)	Score: 84.42
Seq: GCCGTCTTAGCTCAGTGGTAGAGCGCGTGGCTTTTAACCACGTGGcCGTGGGTTCGATCCCCACAGACGGCG
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna89 (3383474-3383401)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (3383440-3383438)	Score: 49.74
Seq: GGGCTTATAGTTTAATTGGTtGAAACGTACCGCTCATAACGGTTATAtTGTAGGTTCGAGCCCTACTAAGCCTA
Str: >>>>>>>..>>>>.........<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna49 (20720152-20720223)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (20720184-20720186)	Score: 57.66
Seq: ATCAAAGTGGTGCAGCGGAAGCGTGATGGGCCCATAACCCACAGGtCACAGGATCGAAACCTGTCTTTGATA
Str: >>>>>>>..>>>>.......<<<<..>>>>.......<<<<......>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna90 (3328739-3328667)	Length: 73 bp
Type: Met	Anticodon: CAT at 34-36 (3328706-3328704)	Score: 59.47
Seq: ACCTACTTGACTCAGCGGTtAGAGTATCGCTTTCATACGGCGAGAGtCATTGGTTCAAATCCAATAGTAGGTA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna12 (3462075-3462148)	Length: 74 bp
Type: Met	Anticodon: CAT at 35-37 (3462109-3462111)	Score: 61.58
Seq: AGCGGGGTAGAGGAATTGGTcAACTCATCAGGCTCATGACCTGAAGAtTACAGGTTCGAATCCTGTCCCCGCAT
Str: .>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<..
                    
chr1.trna214 (15733127-15733056)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (15733095-15733093)	Score: 65.74
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAAGATCGAAACTTGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna48 (20704665-20704736)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (20704697-20704699)	Score: 65.74
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAAGATCGAAACTTGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna168 (25944827-25944898)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (25944859-25944861)	Score: 68.81
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna78 (10066597-10066526)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (10066565-10066563)	Score: 68.81
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna79 (9810368-9810297)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (9810336-9810334)	Score: 68.81
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna47 (23463220-23463291)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (23463252-23463254)	Score: 68.81
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna64 (26938898-26938969)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (26938930-26938932)	Score: 68.81
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna77 (22304923-22304852)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (22304891-22304889)	Score: 68.81
Seq: ATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCTGATA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna89 (16684735-16684664)	Length: 72 bp
Type: Met	Anticodon: CAT at 33-35 (16684703-16684701)	Score: 69.22
Seq: AGCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGtCCCAGGATCGAAACCTGGCTCTGCTA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna216 (11797265-11797181)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (11797231-11797229)	Score: 60.80
Possible intron: 39-49 (11797227-11797217)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctactgagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna8 (1324922-1325006)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (1324956-1324958)	Score: 60.94
Possible intron: 39-49 (1324960-1324970)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctacagagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna70 (14054503-14054419)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (14054469-14054467)	Score: 60.80
Possible intron: 39-49 (14054465-14054455)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctactgagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna47 (14847686-14847770)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (14847720-14847722)	Score: 60.80
Possible intron: 39-49 (14847724-14847734)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctactgagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna50 (15345802-15345718)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (15345768-15345766)	Score: 61.43
Possible intron: 39-49 (15345764-15345754)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctattgagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna38 (19820361-19820446)	Length: 86 bp
Type: Met	Anticodon: CAT at 35-37 (19820395-19820397)	Score: 61.56
Possible intron: 39-50 (19820399-19820410)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctatctgagtaATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>.....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna88 (2232556-2232471)	Length: 86 bp
Type: Met	Anticodon: CAT at 35-37 (2232522-2232520)	Score: 61.56
Possible intron: 39-50 (2232518-2232507)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctatctgagtaATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>.....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna70 (26114793-26114709)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (26114759-26114757)	Score: 60.93
Possible intron: 39-49 (26114755-26114745)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctagtgagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna187 (29448903-29448819)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (29448869-29448867)	Score: 60.80
Possible intron: 39-49 (29448865-29448855)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctactgagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna18 (3676607-3676691)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (3676641-3676643)	Score: 61.43
Possible intron: 39-49 (3676645-3676655)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctattgagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna220 (7884443-7884359)	Length: 85 bp
Type: Met	Anticodon: CAT at 35-37 (7884409-7884407)	Score: 60.80
Possible intron: 39-49 (7884405-7884395)
Seq: GGGGTGGTGGCGCAGTTGGCtAGCGCGTAGGTCTCATAgctactgagtgATCCTGAGGtCGAGAGTTCGAGCCTCTCTCACCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna167 (25931859-25931931)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (25931892-25931894)	Score: 63.59
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTGACACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>.>.>.......<.<.<.....>>>>>.......<<<<<<<.<<<<.
                    
chr1.trna195 (25935812-25935740)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (25935779-25935777)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr1.trna2 (515494-515566)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (515527-515529)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr1.trna243 (909882-909810)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (909849-909847)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr3.trna20 (5275156-5275228)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (5275189-5275191)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr3.trna63 (23062517-23062445)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (23062484-23062482)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr4.trna26 (13704788-13704860)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (13704821-13704823)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr4.trna75 (1520854-1520782)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (1520821-1520819)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr4.trna76 (808342-808270)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (808309-808307)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr5.trna104 (3669073-3669001)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (3669040-3669038)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr5.trna117 (862468-862396)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (862435-862433)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr5.trna43 (22091632-22091704)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (22091665-22091667)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr5.trna44 (22094088-22094160)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (22094121-22094123)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr5.trna75 (22357799-22357727)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (22357766-22357764)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr5.trna76 (22355970-22355898)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (22355937-22355935)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr5.trna96 (8946899-8946827)	Length: 73 bp
Type: Phe	Anticodon: GAA at 34-36 (8946866-8946864)	Score: 77.43
Seq: GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGtCGCGTGTTCGATCCACGCTCACCGCA
Str: >>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr1.trna36 (10089884-10089955)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (10089916-10089918)	Score: 36.67
Seq: GGGCATTTGGTCTAGTGGTATGATTCTTGCTTAGGGTGCGAGAGGcCCGGAGCTCAATTCTCGGAAAACCCC
Str: >>>..>>..>>>.........<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<..<<<.
                    
chr1.trna44 (10096937-10097008)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (10096969-10096971)	Score: 64.32
Seq: TGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: .>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<..
                    
chr1.trna194 (26385888-26385817)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (26385856-26385854)	Score: 69.40
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCGGAGTTCAATTCTCCGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna165 (25833317-25833388)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (25833349-25833351)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna49 (10099411-10099482)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (10099443-10099445)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna40 (14360222-14360293)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (14360254-14360256)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna44 (14363134-14363205)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (14363166-14363168)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna1 (259641-259712)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (259673-259675)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna30 (11076815-11076886)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (11076847-11076849)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna69 (19403723-19403652)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (19403691-19403689)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna3 (1390895-1390966)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (1390927-1390929)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna92 (15844325-15844254)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (15844293-15844291)	Score: 71.75
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna16 (2879306-2879377)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (2879338-2879340)	Score: 72.36
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna204 (22044348-22044277)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (22044316-22044314)	Score: 72.36
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna236 (3431257-3431186)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (3431225-3431223)	Score: 72.36
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna77 (7567471-7567400)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (7567439-7567437)	Score: 72.36
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGAGTTCAATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna43 (14362216-14362287)	Length: 72 bp
Type: Pro	Anticodon: CGG at 33-35 (14362248-14362250)	Score: 71.52
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTCGGGTGCGAGGGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna92 (1707815-1707744)	Length: 72 bp
Type: Pro	Anticodon: CGG at 33-35 (1707783-1707781)	Score: 72.45
Seq: GGGTGTTTGGTCTAGTGGTATGATTCGCGCTTCGGGTGCGCGAGGtCCCGAGTTCGATTCTCGGAACACCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna23 (9144436-9144507)	Length: 72 bp
Type: Pro	Anticodon: CGG at 33-35 (9144468-9144470)	Score: 74.22
Seq: GGGTGTTTGGTCTAGTGGTATGATTCTCGCTTCGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACACCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna83 (3622769-3622698)	Length: 72 bp
Type: Pro	Anticodon: CGG at 33-35 (3622737-3622735)	Score: 74.22
Seq: GGGTGTTTGGTCTAGTGGTATGATTCTCGCTTCGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACACCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna39 (17149474-17149545)	Length: 72 bp
Type: Pro	Anticodon: CGG at 33-35 (17149506-17149508)	Score: 74.22
Seq: GGGTGTTTGGTCTAGTGGTATGATTCTCGCTTCGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACACCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna16 (3495009-3495083)	Length: 75 bp
Type: Pro	Anticodon: TGG at 36-38 (3495044-3495046)	Score: 54.34
Seq: CGAGGTGTAGCGCAGTCtGGTcAGCGCATCTGTTTTGGGTACAGAGGGcCATAGGTTCGAATCCTGTCACCTTGA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna35 (10089423-10089494)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10089455-10089457)	Score: 54.44
Seq: CAGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCAAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: ..>>>>>..>>>.........<<<.>>.>>.......<<.<<.....>>>>>.......<<<<<<<<<<...
                    
chr1.trna60 (10108696-10108767)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10108728-10108730)	Score: 67.03
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGCAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<......>>>>.......<<<<.<<<<<<<.
                    
chr1.trna37 (10090354-10090425)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10090386-10090388)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna38 (10090755-10090826)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10090787-10090789)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna39 (10092311-10092382)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10092343-10092345)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna40 (10092787-10092858)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10092819-10092821)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna41 (10093295-10093366)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10093327-10093329)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna42 (10093732-10093803)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10093764-10093766)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna43 (10094159-10094230)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10094191-10094193)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna45 (10097100-10097171)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10097132-10097134)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna46 (10097704-10097775)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10097736-10097738)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna47 (10098639-10098710)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10098671-10098673)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna48 (10099065-10099136)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10099097-10099099)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna50 (10099813-10099884)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10099845-10099847)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna51 (10100259-10100330)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10100291-10100293)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna52 (10101014-10101085)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10101046-10101048)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna53 (10101586-10101657)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10101618-10101620)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna54 (10101979-10102050)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10102011-10102013)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna55 (10106076-10106147)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10106108-10106110)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna56 (10106514-10106585)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10106546-10106548)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna57 (10106884-10106955)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10106916-10106918)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna58 (10107635-10107706)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10107667-10107669)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna59 (10108375-10108446)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10108407-10108409)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna65 (17159047-17159118)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (17159079-17159081)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna67 (17160971-17161042)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (17161003-17161005)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna68 (17161419-17161490)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (17161451-17161453)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna69 (17162968-17163039)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (17163000-17163002)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna70 (17163409-17163480)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (17163441-17163443)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna71 (17164462-17164533)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (17164494-17164496)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna37 (14357465-14357536)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (14357497-14357499)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna38 (14358438-14358509)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (14358470-14358472)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna39 (14359270-14359341)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (14359302-14359304)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna41 (14360735-14360806)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (14360767-14360769)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna42 (14361177-14361248)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (14361209-14361211)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna45 (14363600-14363671)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (14363632-14363634)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna90 (1920110-1920039)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (1920078-1920076)	Score: 73.73
Seq: GGGCATTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAATGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna31 (7082658-7082729)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (7082690-7082692)	Score: 74.34
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna27 (10319499-10319570)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10319531-10319533)	Score: 74.34
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna28 (10325876-10325947)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (10325908-10325910)	Score: 74.34
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna29 (14470284-14470355)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (14470316-14470318)	Score: 74.34
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna55 (13285503-13285432)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (13285471-13285469)	Score: 74.34
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna22 (6258147-6258218)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (6258179-6258181)	Score: 74.34
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna46 (22973067-22973138)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (22973099-22973101)	Score: 74.34
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna83 (18715960-18715889)	Length: 72 bp
Type: Pro	Anticodon: TGG at 33-35 (18715928-18715926)	Score: 74.34
Seq: GGGCGTTTGGTCTAGTGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGAGTTCGATTCTCGGAACGCCCC
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna34 (10088850-10088921)	Length: 72 bp
Type: Pro	Anticodon: AGG at 33-35 (10088882-10088884)	Score: 38.27
Seq: GGGCTTTTGGTCTAGTGGTATGATTCTTGCTTAGGGTGCGGGAGGtCCCGAGTTCAATTATAGGAATGACTA
Str: >>.>.>>..>>>.........<<<.>>>>>.......<<<<<.....>>.>.........<.<<<<.<.<<.
                    
chr1.trna15 (2751332-2751404)	Length: 73 bp
Type: Arg	Anticodon: CCG at 34-36 (2751365-2751367)	Score: 37.42
Seq: GTTCGCGTGGCCCAATGGAtAAGGCGCTCGCCTCCGGAGGGGGATAtTCTCGGTTCGACCTCCATCGTGAACG
Str: >>>>>>>..>>>..........<<<.>>>.>.......<.<<<......>.>>.......<<.<.<<<<<<<.
                    
chr2.trna10 (3437581-3437649)	Length: 69 bp
Type: Phe	Anticodon: GAA at 30-32 (3437610-3437612)	Score: 29.25
Seq: AGGTAGTAGCTCTGGTAGAGCGAGGGACTGAAAATCCTTCTGtCTGCGGTTCGAATCCGGACTCACTTC
Str: >>>>>>..>>>>.....<<<<.>>>>>.......<<<<<.....>.>>>.......<<<.<<<.<<<<.
                    
chr1.trna63 (12083875-12083945)	Length: 71 bp
Type: Gly	Anticodon: GCC at 33-35 (12083907-12083909)	Score: 27.76
Seq: GCATTAGTCGTCTAGTGGTTGTATTGTAGCCTGCCACTTGACAGtCCAGGGTTCGATTCCCGGATGGTGCA
Str: >>>>>>...>>.>.......<.<<.>>.>.........<.<<....>.>>>.......<<<.<.<<<<<<.
                    
chr2.trna13 (3489586-3489654)	Length: 69 bp
Type: Tyr	Anticodon: GTA at 30-32 (3489615-3489617)	Score: 22.49
Seq: AGGTAGTAGCTCTGGTAGAGTGCAGGACTGTAAATCCTTCTGtGAGCGGTTCGAATCCGCAATCACTTA
Str: >>>>.>>.>>>>.....<<<<..>>>>.......<<<<.......>>>>.......<<<<.<<.<<<<.
                    
chr2.trna85 (8002594-8002514)	Length: 81 bp
Type: Glu	Anticodon: TTC at 35-37 (8002560-8002558)	Score: 32.64
Seq: AGATCTGTAaGCTCAAaTTGGTAGAGCGCTCGTTTTCTtctagtggACGAGAGGtTGGTGGTTCGAATCCACCCAGTTCTG
Str: >>>.>>>...>>>>.........<<<<.>>>>>.............<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chr1.trna173 (27691824-27691895)	Length: 72 bp
Type: Glu	Anticodon: TTC at 34-36 (27691857-27691859)	Score: 46.41
Seq: TCCGATGTCGTCCAGCGGTtAGGATATTTGGCTTTCACCCAGGAGACCCGGGTTCGATTCTTGGAATGGGAA
Str: >>>.>>...>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<.<<.<<<.
                    
chr1.trna238 (2464959-2464889)	Length: 71 bp
Type: Lys	Anticodon: TTT at 33-35 (2464927-2464925)	Score: 28.25
Seq: GGTCGCTTAGCTCAGTTGATAGAGCACCACATTTTTTGTGGTAGaAATCGGTTTGAATCCGATAGCGGCTT
Str: >>>>>>>..>>>>........<<<<.>>>>>.....<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna149 (21306648-21306729)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21306681-21306683)	Score: 55.83
Seq: GTGGACGTGCCGGAGTGGTtATCGGGAATGACTAGAAATCATGGAGGCTTTGCCCGCGCACGTTTGAATCTTGCCGTTTACG
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<...>>>...<<<...>>>.>.......<.<<<<<<<<<<.
                    
chr1.trna155 (21309720-21309801)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21309753-21309755)	Score: 55.83
Seq: GTGGACGTGCCGGAGTGGTtATCGGGAATGACTAGAAATCATGGAGGCTTTGCCCGCGCACGTTTGAATCTTGCCGTTTACG
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<...>>>...<<<...>>>.>.......<.<<<<<<<<<<.
                    
chr1.trna122 (21293777-21293858)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21293810-21293812)	Score: 57.29
Seq: GTGGAAGTGCCGGAGTGGTtATCGGGAATGACTAGAAATCATGGGGGCTTTGCCCGCGCAGGTTTGAATCTTGCCGTTTACG
Str: >>>>>.>..>>>>........<<<<..>>>>.......<<<<..>>>>...<<<<..>>>>>.......<<<<<<.<<<<<.
                    
chr1.trna128 (21296657-21296738)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21296690-21296692)	Score: 57.29
Seq: GTGGAAGTGCCGGAGTGGTtATCGGGAATGACTAGAAATCATGGGGGCTTTGCCCGCGCAGGTTTGAATCTTGCCGTTTACG
Str: >>>>>.>..>>>>........<<<<..>>>>.......<<<<..>>>>...<<<<..>>>>>.......<<<<<<.<<<<<.
                    
chr1.trna152 (21308185-21308268)	Length: 84 bp
Type: Ser	Anticodon: AGA at 36-38 (21308220-21308222)	Score: 57.41
Seq: GTGGACATGCCGGAGTGGTgttATCGGGCATAACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCATGCCGTTTACG
Str: >>>>>>...>>>>..........<<<<.>>>.>.......<.<<<.>>>>...<<<<..>>>.>.......<.<<<.<<<<<<.
                    
chr1.trna158 (21311257-21311340)	Length: 84 bp
Type: Ser	Anticodon: AGA at 36-38 (21311292-21311294)	Score: 57.41
Seq: GTGGACATGCCGGAGTGGTgttATCGGGCATAACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCATGCCGTTTACG
Str: >>>>>>...>>>>..........<<<<.>>>.>.......<.<<<.>>>>...<<<<..>>>.>.......<.<<<.<<<<<<.
                    
chr1.trna134 (21299537-21299618)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21299570-21299572)	Score: 61.91
Seq: GTGGACGTGCCGGAGTGGTtATCGGGAATGACTAGAAATCATGGGGGCTTTGCCCGCGCAGGTTTGAATCTTGCCGTTTACG
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<..>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna140 (21302418-21302499)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21302451-21302453)	Score: 61.91
Seq: GTGGACGTGCCGGAGTGGTtATCGGGAATGACTAGAAATCATGGGGGCTTTGCCCGCGCAGGTTTGAATCTTGCCGTTTACG
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<..>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna146 (21305299-21305380)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21305332-21305334)	Score: 61.91
Seq: GTGGACGTGCCGGAGTGGTtATCGGGAATGACTAGAAATCATGGGGGCTTTGCCCGCGCAGGTTTGAATCTTGCCGTTTACG
Str: >>>>>>>..>>>>........<<<<..>>>>.......<<<<..>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna80 (21272452-21272533)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21272485-21272487)	Score: 75.14
Seq: GTGGAAGTGGCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>.>...>>>........<<<..>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<.<<<<<.
                    
chr1.trna86 (21275470-21275551)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21275503-21275505)	Score: 75.14
Seq: GTGGAAGTGGCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>.>...>>>........<<<..>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<.<<<<<.
                    
chr1.trna101 (21283055-21283136)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21283088-21283090)	Score: 76.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATAACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>.>.......<.<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna92 (21278488-21278569)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21278521-21278523)	Score: 79.70
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGTTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna98 (21281526-21281607)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21281559-21281561)	Score: 79.70
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGTTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna4 (586093-586174)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (586126-586128)	Score: 81.73
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTCTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna104 (21284587-21284668)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21284620-21284622)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna107 (21286119-21286200)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21286152-21286154)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna110 (21287651-21287732)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21287684-21287686)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna113 (21289184-21289265)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21289217-21289219)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna116 (21290715-21290796)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21290748-21290750)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna119 (21292246-21292327)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21292279-21292281)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna125 (21295126-21295207)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21295159-21295161)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna131 (21298006-21298087)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21298039-21298041)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna137 (21300886-21300967)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21300919-21300921)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna143 (21303767-21303848)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21303800-21303802)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna172 (27397047-27397128)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (27397080-27397082)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna184 (30242676-30242757)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (30242709-30242711)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna196 (24490736-24490655)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (24490703-24490701)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna205 (21887589-21887508)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21887556-21887554)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna24 (5380902-5380983)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (5380935-5380937)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna83 (21273961-21274042)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21273994-21273996)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna89 (21276979-21277060)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21277012-21277014)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna95 (21280017-21280098)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (21280050-21280052)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna20 (5358919-5359000)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (5358952-5358954)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna41 (20773556-20773637)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (20773589-20773591)	Score: 82.22
Seq: GTGGACGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGTTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna36 (17275565-17275646)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (17275598-17275600)	Score: 82.83
Seq: GTGGGCGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGCTCACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna25 (6038750-6038831)	Length: 82 bp
Type: Ser	Anticodon: AGA at 34-36 (6038783-6038785)	Score: 84.50
Seq: GTAGGCGTGCCGGAGTGGTtATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCCGCCTACG
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna48 (23661937-23662018)	Length: 82 bp
Type: Ser	Anticodon: CGA at 34-36 (23661970-23661972)	Score: 81.35
Seq: GTCAATATGTCCGAGTGGTtAAGGAGACAGACTCGAAATCTGTTGGGCTTTGCCTGCGCAGGTTCGAATCCTGCTGTTGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna2 (614642-614723)	Length: 82 bp
Type: Ser	Anticodon: CGA at 34-36 (614675-614677)	Score: 85.19
Seq: GTCGATATGTCCGAGTGGTtAAGGAGATTGACTCGAAATCAATTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna11 (2944617-2944698)	Length: 82 bp
Type: Ser	Anticodon: CGA at 34-36 (2944650-2944652)	Score: 85.25
Seq: GTCAATATGTCCGAGTGGTtAAGGAGATTGACTCGAAATCAATTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCTGTTGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna34 (15804554-15804635)	Length: 82 bp
Type: Ser	Anticodon: CGA at 34-36 (15804587-15804589)	Score: 85.25
Seq: GTCAATATGTCCGAGTGGTtAAGGAGATTGACTCGAAATCAATTGGGCTTTGCCCGCGCAGGTTCGAATCCTGCTGTTGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna65 (22197892-22197811)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (22197859-22197857)	Score: 69.54
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTTCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTGTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>.>.......<.<<<.>>>>...<<<<..>>.>>.......<<.<<<<<<<<<.
                    
chr3.trna78 (7319664-7319583)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (7319631-7319629)	Score: 76.07
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGATTTTCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna69 (26174496-26174415)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (26174463-26174461)	Score: 78.42
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGCTCGCCTGCTAAGTGAGTGGGATTTTCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna50 (21498294-21498375)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (21498327-21498329)	Score: 79.46
Seq: GACACTTTGGCCGAGTGGTtAAGGCGTTTGCCTGCTAAGTAAATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGTGTCG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna61 (18317134-18317053)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (18317101-18317099)	Score: 79.53
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna28 (14267287-14267368)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (14267320-14267322)	Score: 79.53
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna106 (3287635-3287554)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (3287602-3287600)	Score: 79.53
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna189 (29007180-29007099)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (29007147-29007145)	Score: 80.11
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGCTCTGCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna24 (12686149-12686230)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (12686182-12686184)	Score: 80.11
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTGTGCCTGCTAAGTACATGGGCTCTGCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna63 (17545862-17545781)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (17545829-17545827)	Score: 81.30
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTTTGCCTGCTAAGTAAATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna114 (2060235-2060154)	Length: 82 bp
Type: Ser	Anticodon: GCT at 34-36 (2060202-2060200)	Score: 81.30
Seq: GTCGCTTTGGCCGAGTGGTtAAGGCGTTTGCCTGCTAAGTAAATGGGGTTTCCCCGCGAGAGTTCGAATCTCTCAGGCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna91 (3303819-3303732)	Length: 88 bp
Type: Ser	Anticodon: GCT at 35-37 (3303785-3303783)	Score: 40.19
Possible intron: 39-46 (3303781-3303774)
Seq: GGAGGGATGGCTGAGTGGCttAAGGCATTGGTTTGCTAaatcgacaTACAAGAAGATTgTAtCATGGGTTCGAATCCCATTTCCTCCG
Str: >>>>>>>..>>>...........<<<.>>.>>...............<<.<<..>....<...>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna14 (3494379-3494466)	Length: 88 bp
Type: Ser	Anticodon: GCT at 35-37 (3494413-3494415)	Score: 40.19
Possible intron: 39-46 (3494417-3494424)
Seq: GGAGGGATGGCTGAGTGGCttAAGGCATTGGTTTGCTAaatcgacaTACAAGAAGATTgTAtCATGGGTTCGAATCCCATTTCCTCCG
Str: >>>>>>>..>>>...........<<<.>>.>>...............<<.<<..>....<...>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna11 (3452974-3453060)	Length: 87 bp
Type: Ser	Anticodon: GGA at 35-37 (3453008-3453010)	Score: 58.88
Seq: GGAGAGATGGCCGAGTGGTttAAGGCGTAGCATTGGAACTGCTATGTAGGCTTTTGTTTACCGAGGGTTCGAATCCCTCTCTTTCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<..>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna20 (3503519-3503605)	Length: 87 bp
Type: Ser	Anticodon: TGA at 35-37 (3503553-3503555)	Score: 56.81
Seq: GGATGGATGTCTGAGCGGTtgAAAGAGTCGGTCTTGAAAACCGAAGTATTTCTAGGAATAcCGGGGGTTCGAATCCCTCTCCATCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>.>>....<<.<<...>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna9 (3369351-3369437)	Length: 87 bp
Type: Ser	Anticodon: TGA at 35-37 (3369385-3369387)	Score: 56.81
Seq: GGATGGATGTCTGAGCGGTtgAAAGAGTCGGTCTTGAAAACCGAAGTATTTCTAGGAATAcCGGGGGTTCGAATCCCTCTCCATCCG
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>.>>....<<.<<...>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna79 (20794977-20795058)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (20795010-20795012)	Score: 80.82
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna57 (13058922-13058841)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (13058889-13058887)	Score: 80.82
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna80 (21275141-21275060)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (21275108-21275106)	Score: 80.82
Seq: GTCGATATGTCCGAGTGGTtAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna87 (2253762-2253681)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (2253729-2253727)	Score: 80.89
Seq: GTCAATATGTCCGAGTGGTtAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTTGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna85 (2945782-2945701)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (2945749-2945747)	Score: 81.08
Seq: GTCGATATGTCCGAGTGGTtAAGGAGATAGACTTGAAATCTATTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna118 (642479-642398)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (642446-642444)	Score: 81.08
Seq: GTCGATATGTCCGAGTGGTtAAGGAGATAGACTTGAAATCTATTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna180 (28639586-28639667)	Length: 82 bp
Type: Ser	Anticodon: TGA at 34-36 (28639619-28639621)	Score: 81.15
Seq: GTCAATATGTCCGAGTGGTtAAGGAGATAGACTTGAAATCTATTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTTGACG
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna211 (18234220-18234147)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (18234186-18234184)	Score: 70.04
Seq: GCTCTCGTAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAACGAAAGCA
Str: >>>.>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chr4.trna37 (16655291-16655364)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (16655325-16655327)	Score: 70.04
Seq: GCTCTCGTAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAACGAAAGCA
Str: >>>.>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<.<<<.
                    
chr2.trna69 (14750627-14750554)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (14750593-14750591)	Score: 74.28
Seq: GCTTTCATAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAATGAAAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna17 (9287231-9287304)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (9287265-9287267)	Score: 74.28
Seq: GCTTTCATAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAATGAAAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna49 (15430303-15430230)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (15430269-15430267)	Score: 74.28
Seq: GCTTTCATAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAATGAAAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna62 (10878807-10878734)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (10878773-10878771)	Score: 74.28
Seq: GCTTTCATAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAATGAAAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna33 (18058015-18058088)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (18058049-18058051)	Score: 74.28
Seq: GCTTTCATAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAATGAAAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna80 (6484019-6483946)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (6483985-6483983)	Score: 75.17
Seq: GCTCTCGTAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAACGAGAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna15 (9108318-9108391)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (9108352-9108354)	Score: 75.17
Seq: GCTCTCGTAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAACGAGAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna68 (8301794-8301721)	Length: 74 bp
Type: Thr	Anticodon: AGT at 35-37 (8301760-8301758)	Score: 75.17
Seq: GCTCTCGTAGCTCAGTTGGTtAGAGCACCCGTTTAGTAAGCGGGAGGtCTTGAGTTCAACTCTCAACGAGAGCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna46 (14757143-14757213)	Length: 71 bp
Type: Thr	Anticodon: CGT at 36-38 (14757178-14757180)	Score: 22.63
Seq: CTTAGGATGGCCGAGTGGAcAcAAGTTCTgGTCCTCGTAAGAGGGTGTGGGTTCAAACCCCACTTCTGACA
Str: .>>>>>>..>>.............<<.>>...>.......<<<...>>>>>.......<<<<<<<<<<<..
                    
chr2.trna97 (1114052-1113981)	Length: 72 bp
Type: Thr	Anticodon: CGT at 33-35 (1114020-1114018)	Score: 77.36
Seq: GCCTCCGTAGCATAGTGGTATTGCGTTCGCTTCGTAAGCGAAAGGtCGTGAGTTCGATCCTCACCGTAGGCT
Str: >>>>.>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
                    
chr2.trna96 (1123458-1123387)	Length: 72 bp
Type: Thr	Anticodon: CGT at 33-35 (1123426-1123424)	Score: 79.41
Seq: GCCTCTGTAGCATAGTGGTATTGCGTTCGCTTCGTAAGCGAAAGGcCGCGAGTTCGATCCTCGCCGGAGGCT
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna178 (28444550-28444621)	Length: 72 bp
Type: Thr	Anticodon: CGT at 33-35 (28444582-28444584)	Score: 80.56
Seq: GCCTCCGTAGCATAGTGGTATTGCGTTCGCTTCGTAAGCGAAAGGcCGCGAGTTCGATCCTCGCCGGGGGCT
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna21 (4709632-4709703)	Length: 72 bp
Type: Thr	Anticodon: CGT at 33-35 (4709664-4709666)	Score: 80.56
Seq: GCCTCCGTAGCATAGTGGTATTGCGTTCGCTTCGTAAGCGAAAGGcCGCGAGTTCGATCCTCGCCGGGGGCT
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna54 (24548893-24548964)	Length: 72 bp
Type: Thr	Anticodon: CGT at 33-35 (24548925-24548927)	Score: 80.56
Seq: GCCTCCGTAGCATAGTGGTATTGCGTTCGCTTCGTAAGCGAAAGGcCGCGAGTTCGATCCTCGCCGGGGGCT
Str: >>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna52 (21970487-21970557)	Length: 71 bp
Type: Thr	Anticodon: TGT at 33-35 (21970519-21970521)	Score: 67.75
Seq: GCCCGTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGTGGCA
Str: >>>.>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<.
                    
chr2.trna62 (18002721-18002650)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (18002689-18002687)	Score: 73.80
Seq: GCCCGTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCTATCCTGCGTGTGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna9 (1817399-1817470)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (1817431-1817433)	Score: 80.35
Seq: GCCCGTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGTGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna4 (1442005-1442076)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (1442037-1442039)	Score: 80.35
Seq: GCCCGTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGTGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna8 (6944722-6944793)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (6944754-6944756)	Score: 80.35
Seq: GCCCGTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGTGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna58 (25347262-25347333)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (25347294-25347296)	Score: 80.35
Seq: GCCCGTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGTGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna197 (23671219-23671148)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (23671187-23671185)	Score: 81.19
Seq: GCCCTTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGAGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna37 (17905396-17905467)	Length: 72 bp
Type: Thr	Anticodon: TGT at 33-35 (17905428-17905430)	Score: 81.19
Seq: GCCCTTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGtCCGTAGTTCGATCCTGCGTGAGGGCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna6 (3280860-3280933)	Length: 74 bp
Type: Trp	Anticodon: CCA at 35-37 (3280894-3280896)	Score: 67.55
Seq: GCGCTCTTAGTTCAGTTcGGTAGAACGTGGGTCTCCAAAACCCAATGtCGTAGGTTCAAATCCTACAGAGCGTG
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna21 (5984379-5984450)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (5984411-5984413)	Score: 70.65
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCTTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>.>>.......<<.<<<<<<<<<.
                    
chr1.trna223 (7242821-7242750)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (7242789-7242787)	Score: 75.00
Seq: GGATTCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna185 (30178977-30178906)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (30178945-30178943)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna199 (22870494-22870423)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (22870462-22870460)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna229 (5309713-5309642)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (5309681-5309679)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna234 (3914700-3914629)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (3914668-3914666)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna5 (981976-982047)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (982008-982010)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna6 (984106-984177)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (984138-984140)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna41 (18395022-18395093)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (18395054-18395056)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna66 (9873596-9873525)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (9873564-9873562)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna67 (9815287-9815216)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (9815255-9815253)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna102 (5966044-5965973)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (5966012-5966010)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna103 (5962771-5962700)	Length: 72 bp
Type: Trp	Anticodon: CCA at 33-35 (5962739-5962737)	Score: 77.63
Seq: GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCGATTCACGTCGGGTTCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna8 (3332675-3332756)	Length: 82 bp
Type: Tyr	Anticodon: GTA at 34-36 (3332708-3332710)	Score: 32.67
Seq: GGGAAAGGGGAGAGTGGTcAAAAgCGGCAGACTGTAAATCTGTTGAAGTTTTTCTACGTAGGTTCGAATCCTGCCTCTCCCA
Str: >>>>.>>..>..............<.>>>>>.......<<<<<..>.>....<.<..>>>>>.......<<<<<<<.<<<<.
                    
chr2.trna4 (3268804-3268883)	Length: 80 bp
Type: Tyr	Anticodon: GTA at 35-37 (3268838-3268840)	Score: 39.02
Seq: TCACAGGTAGCTCAGATGGTtAGAGCAAAGGACTGTAAATCCTTGTGtTAGTGGTTCGATTccacaaCCACTTCTATGCG
Str: .>>.>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.............<<<<<<<<.<<..
                    
chr2.trna15 (3494773-3494847)	Length: 75 bp
Type: Tyr	Anticodon: GTA at 36-38 (3494808-3494810)	Score: 52.74
Seq: AAGTGGTTcAGCTCAGCTGGTtAGAGCAAAGGACTGTAAATCCTTGTGtCAGTGGTTCGAATCCACAACCACTTC
Str: >>>>>>>...>>>>.........<<<<.>>>>>.......<<<<<......>>>>.......<<<<.<<<<<<<.
                    
chr2.trna92 (3303425-3303351)	Length: 75 bp
Type: Tyr	Anticodon: GTA at 36-38 (3303390-3303388)	Score: 52.74
Seq: AAGTGGTTcAGCTCAGCTGGTtAGAGCAAAGGACTGTAAATCCTTGTGtCAGTGGTTCGAATCCACAACCACTTC
Str: >>>>>>>...>>>>.........<<<<.>>>>>.......<<<<<......>>>>.......<<<<.<<<<<<<.
                    
chr3.trna24 (7104315-7104398)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 35-37 (7104349-7104351)	Score: 53.74
Seq: GGGTCGATGCCCGAGCGGTtaATGGGGACGGACTGTAAATTCGTTGGCAATATGTCTACGCTGGTTCAAATCCAGCTCGGCCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<..>.>.....<.<..>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna19 (3497355-3497437)	Length: 83 bp
Type: Tyr	Anticodon: GTA at 35-37 (3497389-3497391)	Score: 56.98
Seq: GGGAGAGTGGCCGAGTGGTcaAAAGCGGCAGACTGTAAATCTGTTGAAGTTTTTCTACGTAGGTTCGAATCCTGCCTCTCCCA
Str: >>>>>>>..>>.............<<.>>>>>.......<<<<<..>.>....<.<..>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna61 (11774558-11774473)	Length: 86 bp
Type: Tyr	Anticodon: GTA at 34-36 (11774525-11774523)	Score: 77.17
Possible intron: 38-50 (11774521-11774509)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtctttgacagataATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>....................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna68 (15215517-15215434)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (15215484-15215482)	Score: 76.77
Possible intron: 38-48 (15215480-15215470)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtagttgctgtaATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna66 (15477324-15477241)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (15477291-15477289)	Score: 76.91
Possible intron: 38-48 (15477287-15477277)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtagtagctgtaATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna73 (17985661-17985576)	Length: 86 bp
Type: Tyr	Anticodon: GTA at 34-36 (17985628-17985626)	Score: 76.04
Possible intron: 38-50 (17985624-17985612)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtctgtgacagcaaATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>....................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna45 (18255066-18254983)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (18255033-18255031)	Score: 76.77
Possible intron: 38-48 (18255029-18255019)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtagttgctgtaATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna73 (18312571-18312655)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (18312604-18312606)	Score: 76.40
Possible intron: 38-49 (18312608-18312619)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtgtttgcagacaATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna209 (19688887-19688802)	Length: 86 bp
Type: Tyr	Anticodon: GTA at 34-36 (19688854-19688852)	Score: 77.17
Possible intron: 38-50 (19688850-19688838)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtctttgacagataATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>....................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna81 (20758940-20758852)	Length: 89 bp
Type: Tyr	Anticodon: GTA at 34-36 (20758907-20758905)	Score: 77.34
Possible intron: 38-53 (20758903-20758888)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGttgtttgcaacagaaaATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna81 (21272787-21272871)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21272820-21272822)	Score: 68.66
Possible intron: 38-49 (21272824-21272835)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagattATCCTTAGGtCATTGGTTCGAATCCGCTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr1.trna82 (21273217-21273301)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21273250-21273252)	Score: 74.91
Possible intron: 38-49 (21273254-21273265)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna84 (21274296-21274380)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21274329-21274331)	Score: 68.66
Possible intron: 38-49 (21274333-21274344)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagattATCCTTAGGtCATTGGTTCGAATCCGCTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr1.trna85 (21274726-21274810)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21274759-21274761)	Score: 74.91
Possible intron: 38-49 (21274763-21274774)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna87 (21275805-21275889)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21275838-21275840)	Score: 68.66
Possible intron: 38-49 (21275842-21275853)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagattATCCTTAGGtCATTGGTTCGAATCCGCTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr1.trna88 (21276235-21276319)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21276268-21276270)	Score: 74.91
Possible intron: 38-49 (21276272-21276283)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna90 (21277314-21277398)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21277347-21277349)	Score: 68.66
Possible intron: 38-49 (21277351-21277362)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagattATCCTTAGGtCATTGGTTCGAATCCGCTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr1.trna91 (21277744-21277828)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21277777-21277779)	Score: 74.91
Possible intron: 38-49 (21277781-21277792)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna93 (21278823-21278907)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21278856-21278858)	Score: 74.76
Possible intron: 38-49 (21278860-21278871)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna94 (21279274-21279358)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21279307-21279309)	Score: 75.54
Possible intron: 38-49 (21279311-21279322)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgtagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna96 (21280352-21280436)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21280385-21280387)	Score: 68.66
Possible intron: 38-49 (21280389-21280400)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagattATCCTTAGGtCATTGGTTCGAATCCGCTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>.>>>.......<<<.<<<<<<<<.
                    
chr1.trna97 (21280782-21280866)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21280815-21280817)	Score: 74.91
Possible intron: 38-49 (21280819-21280830)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna99 (21281861-21281945)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21281894-21281896)	Score: 74.76
Possible intron: 38-49 (21281898-21281909)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna100 (21282312-21282396)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21282345-21282347)	Score: 75.54
Possible intron: 38-49 (21282349-21282360)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgtagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna102 (21283385-21283469)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21283418-21283420)	Score: 74.91
Possible intron: 38-49 (21283422-21283433)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna103 (21283843-21283927)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21283876-21283878)	Score: 74.91
Possible intron: 38-49 (21283880-21283891)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna105 (21284917-21285001)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21284950-21284952)	Score: 74.91
Possible intron: 38-49 (21284954-21284965)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna106 (21285375-21285459)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21285408-21285410)	Score: 63.52
Possible intron: 38-49 (21285412-21285423)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCTGGTAGGTTTGA
Str: >.>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<.<.
                    
chr1.trna108 (21286449-21286533)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21286482-21286484)	Score: 74.91
Possible intron: 38-49 (21286486-21286497)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna109 (21286907-21286991)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21286940-21286942)	Score: 74.91
Possible intron: 38-49 (21286944-21286955)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna111 (21287981-21288065)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21288014-21288016)	Score: 74.91
Possible intron: 38-49 (21288018-21288029)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna112 (21288439-21288523)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21288472-21288474)	Score: 74.91
Possible intron: 38-49 (21288476-21288487)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna114 (21289514-21289598)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21289547-21289549)	Score: 74.91
Possible intron: 38-49 (21289551-21289562)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna115 (21289971-21290055)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21290004-21290006)	Score: 74.91
Possible intron: 38-49 (21290008-21290019)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna117 (21291045-21291129)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21291078-21291080)	Score: 74.91
Possible intron: 38-49 (21291082-21291093)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna118 (21291502-21291586)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21291535-21291537)	Score: 74.91
Possible intron: 38-49 (21291539-21291550)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna120 (21292575-21292659)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21292608-21292610)	Score: 74.91
Possible intron: 38-49 (21292612-21292623)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna121 (21293033-21293117)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21293066-21293068)	Score: 74.91
Possible intron: 38-49 (21293070-21293081)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna123 (21294110-21294194)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21294143-21294145)	Score: 70.61
Possible intron: 38-49 (21294147-21294158)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCATTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna124 (21294568-21294652)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21294601-21294603)	Score: 65.30
Possible intron: 38-49 (21294605-21294616)
Seq: CCGACTTTAGCTCAGTTGGTAGAGCGGAGGACAGTAGaagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna126 (21295456-21295540)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21295489-21295491)	Score: 68.58
Possible intron: 38-49 (21295493-21295504)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATTCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna127 (21295913-21295997)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21295946-21295948)	Score: 74.91
Possible intron: 38-49 (21295950-21295961)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna129 (21296990-21297074)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21297023-21297025)	Score: 70.61
Possible intron: 38-49 (21297027-21297038)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCATTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna130 (21297448-21297532)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21297481-21297483)	Score: 65.30
Possible intron: 38-49 (21297485-21297496)
Seq: CCGACTTTAGCTCAGTTGGTAGAGCGGAGGACAGTAGaagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna132 (21298336-21298420)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21298369-21298371)	Score: 68.58
Possible intron: 38-49 (21298373-21298384)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATTCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna133 (21298793-21298877)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21298826-21298828)	Score: 74.91
Possible intron: 38-49 (21298830-21298841)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna135 (21299870-21299954)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21299903-21299905)	Score: 70.61
Possible intron: 38-49 (21299907-21299918)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCATTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna136 (21300328-21300412)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21300361-21300363)	Score: 63.02
Possible intron: 38-49 (21300365-21300376)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACAGTAGaagacgcagattATCCTTAGGtCACAGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>.>>.......<<.<<<<<<<<<.
                    
chr1.trna138 (21301216-21301300)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21301249-21301251)	Score: 58.50
Possible intron: 38-49 (21301253-21301264)
Seq: CCAACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATTTGGTAGGTCGGA
Str: >>.>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<.<<.
                    
chr1.trna139 (21301674-21301758)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21301707-21301709)	Score: 74.91
Possible intron: 38-49 (21301711-21301722)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna141 (21302751-21302835)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21302784-21302786)	Score: 70.61
Possible intron: 38-49 (21302788-21302799)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCATTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna142 (21303209-21303293)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21303242-21303244)	Score: 63.02
Possible intron: 38-49 (21303246-21303257)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACAGTAGaagacgcagattATCCTTAGGtCACAGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>.>>.......<<.<<<<<<<<<.
                    
chr1.trna144 (21304097-21304181)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21304130-21304132)	Score: 58.50
Possible intron: 38-49 (21304134-21304145)
Seq: CCAACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATTTGGTAGGTCGGA
Str: >>.>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<.<<.
                    
chr1.trna145 (21304555-21304639)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21304588-21304590)	Score: 74.91
Possible intron: 38-49 (21304592-21304603)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna147 (21305632-21305716)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21305665-21305667)	Score: 70.61
Possible intron: 38-49 (21305669-21305680)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCATTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna148 (21306090-21306174)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21306123-21306125)	Score: 58.73
Possible intron: 38-49 (21306127-21306138)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACAGTAGaagacgcagattATCCTTAGGtCATAGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>.>>.......<<.<<<<<<<<<.
                    
chr1.trna150 (21306982-21307066)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21307015-21307017)	Score: 75.68
Possible intron: 38-49 (21307019-21307030)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgaagcagataATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna151 (21307442-21307526)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21307475-21307477)	Score: 74.91
Possible intron: 38-49 (21307479-21307490)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna153 (21308521-21308600)	Length: 80 bp
Type: Tyr	Anticodon: GTA at 34-36 (21308554-21308556)	Score: 55.49
Possible intron: 38-44 (21308558-21308564)
Seq: CCGACCTTAGCTCTGTTGGTATAGCGGAGGACTGTAGttgacgcATCCTTAGGtCACTGGTTCGAATTCGGTAGGTCGGA
Str: >>>>>>>..>>>..........<<<.>>>>>..............<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna154 (21308976-21309060)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21309009-21309011)	Score: 74.91
Possible intron: 38-49 (21309013-21309024)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna156 (21310054-21310138)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21310087-21310089)	Score: 75.68
Possible intron: 38-49 (21310091-21310102)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGttgaagcagataATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna157 (21310514-21310598)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21310547-21310549)	Score: 74.91
Possible intron: 38-49 (21310551-21310562)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna159 (21311593-21311677)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21311626-21311628)	Score: 56.05
Possible intron: 38-49 (21311630-21311641)
Seq: CCGACCTTAGCTCTGTTGGTATAGCGGAGGACTGTAGttgacgcagataATCCTTAGGtCACTGGTTCGAATTCGGTAGGTCGGA
Str: >>>>>>>..>>>..........<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna160 (21312052-21312136)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (21312085-21312087)	Score: 74.91
Possible intron: 38-49 (21312089-21312100)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGtagacgcagattATCCTTAGGtCACTGGTTCGAATCCGGTAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna112 (2309549-2309464)	Length: 86 bp
Type: Tyr	Anticodon: GTA at 34-36 (2309516-2309514)	Score: 76.04
Possible intron: 38-50 (2309512-2309500)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtctgtgacagcaaATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>....................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna57 (24856206-24856290)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (24856239-24856241)	Score: 78.43
Possible intron: 38-49 (24856243-24856254)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAAtgtttgcagataATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna84 (3238461-3238372)	Length: 90 bp
Type: Tyr	Anticodon: GTA at 34-36 (3238428-3238426)	Score: 73.56
Possible intron: 38-54 (3238424-3238408)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAAtgggtaattccaaagaaATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTTGAA
Str: .>>>>>>..>>>>........<<<<.>>>>>........................<<<<<.....>>>>>.......<<<<<<<<<<<..
                    
chr3.trna22 (6540637-6540721)	Length: 85 bp
Type: Tyr	Anticodon: GTA at 34-36 (6540670-6540672)	Score: 75.91
Possible intron: 38-49 (6540674-6540685)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGgcgttgcagataATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna7 (6819288-6819371)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (6819321-6819323)	Score: 76.91
Possible intron: 38-48 (6819325-6819335)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtagttgctgaaATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna87 (6953961-6953873)	Length: 89 bp
Type: Tyr	Anticodon: GTA at 34-36 (6953928-6953926)	Score: 78.61
Possible intron: 38-53 (6953924-6953909)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGttgtttaaaacagataATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna3 (858535-858618)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (858568-858570)	Score: 76.91
Possible intron: 38-48 (858572-858582)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtagtagctgtaATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna84 (9241356-9241273)	Length: 84 bp
Type: Tyr	Anticodon: GTA at 34-36 (9241323-9241321)	Score: 76.13
Possible intron: 38-48 (9241319-9241309)
Seq: CCGACCTTAGCTCAGTTGGTAGAGCGGAAGACTGTAGtagttgctgtgATCTTTAGGtCGCTGGTTCGATTCCGGCAGGTCGGA
Str: >>>>>>>..>>>>........<<<<.>>>>>..................<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna206 (21378054-21377984)	Length: 71 bp
Type: Undet	Anticodon: ??? at 0-0 (0-0)	Score: 27.18
Seq: TCCGCTGTAGCACAATGGTtAAAACAGCTGTCTAAACATCTGAttTCCGAGTTCAAAGCTCGGCAGTGGAA
Str: >>>>>>>..>..............<.>.>>......<<.<......>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna78 (562634-562561)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (562600-562598)	Score: 43.60
Seq: GGTTTCGTGGTGTAGTTGTTtATCACGTCATTCTAACACAACTAAGGtTTCTGGTTCGAACCCGGTCAAAACCA
Str: >>>>>.>..>>>...........<<<.>..>>.......<<..<......>>>>.......<<<<.<.<<<<<.
                    
chr3.trna33 (16902624-16902697)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (16902658-16902660)	Score: 70.95
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTAAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>.>>>.......<<<.<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna217 (10963627-10963554)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (10963593-10963591)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna219 (8520352-8520279)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (8520318-8520316)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna226 (6076011-6075938)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (6075977-6075975)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna233 (4267059-4266986)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (4267025-4267023)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna32 (16896876-16896949)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (16896910-16896912)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna34 (16905148-16905221)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (16905182-16905184)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna39 (18518797-18518870)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (18518831-18518833)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna53 (22149700-22149773)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (22149734-22149736)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna9 (7185698-7185771)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (7185732-7185734)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna1 (530820-530893)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (530854-530856)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna10 (2993328-2993401)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (2993362-2993364)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna59 (25801341-25801414)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (25801375-25801377)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna72 (24157245-24157172)	Length: 74 bp
Type: Val	Anticodon: AAC at 35-37 (24157211-24157209)	Score: 77.22
Seq: GGTTTCGTGGTGTAGTTGGTtATCACGTCAGTCTAACACACTGAAGGtCTCCGGTTCGAACCCGGGCGAAGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna15 (3575850-3575923)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (3575884-3575886)	Score: 85.02
Seq: GTCTGGGTAGTGTAGTCGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna25 (9400750-9400823)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (9400784-9400786)	Score: 85.42
Seq: GTCTGGGTGGTGTAGTCGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna25 (9840421-9840494)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (9840455-9840457)	Score: 85.42
Seq: GTCTGGGTGGTGTAGTCGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna42 (18411259-18411332)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (18411293-18411295)	Score: 85.42
Seq: GTCTGGGTGGTGTAGTCGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna17 (4929563-4929636)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (4929597-4929599)	Score: 85.42
Seq: GTCTGGGTGGTGTAGTCGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna28 (15242548-15242621)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (15242582-15242584)	Score: 85.42
Seq: GTCTGGGTGGTGTAGTCGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna73 (23072070-23071997)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (23072036-23072034)	Score: 85.42
Seq: GTCTGGGTGGTGTAGTCGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna8 (1804617-1804690)	Length: 74 bp
Type: Val	Anticodon: CAC at 35-37 (1804651-1804653)	Score: 85.42
Seq: GTCTGGGTGGTGTAGTCGGTtATCACGCTAGTCTCACACACTAGAGGtCCCCGGTTCGAACCCGGGCTCAGACA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna41 (18907852-18907924)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (18907885-18907887)	Score: 76.93
Seq: GGTGCTGTGGTGTAGTGGTtATCACGTTTGCCTTACACGCAAAAGGtCTCCAGTTCGACCCTGGGCAGCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr4.trna16 (9191591-9191663)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (9191624-9191626)	Score: 77.60
Seq: GATTCTGTGGTGTAGTGGTtATCACGTTTGCCTTACACGCAAAAGGtCTCCAGTTCGATCCTGGGCAGAATCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr1.trna1 (306384-306456)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (306417-306419)	Score: 79.63
Seq: GGTGCTGTGGTGTAGTGGTtATCACGTTTGCCTTACACGCAAAAGGtCTCCAGTTCGATCCTGGGCAGCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna3 (1154382-1154454)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (1154415-1154417)	Score: 79.63
Seq: GGTGCTGTGGTGTAGTGGTtATCACGTTTGCCTTACACGCAAAAGGtCTCCAGTTCGATCCTGGGCAGCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr2.trna73 (12645305-12645233)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (12645272-12645270)	Score: 79.63
Seq: GGTGCTGTGGTGTAGTGGTtATCACGTTTGCCTTACACGCAAAAGGtCTCCAGTTCGATCCTGGGCAGCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr3.trna9 (2222252-2222324)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (2222285-2222287)	Score: 79.63
Seq: GGTGCTGTGGTGTAGTGGTtATCACGTTTGCCTTACACGCAAAAGGtCTCCAGTTCGATCCTGGGCAGCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
                    
chr5.trna85 (17894979-17894907)	Length: 73 bp
Type: Val	Anticodon: TAC at 34-36 (17894946-17894944)	Score: 79.63
Seq: GGTGCTGTGGTGTAGTGGTtATCACGTTTGCCTTACACGCAAAAGGtCTCCAGTTCGATCCTGGGCAGCACCA
Str: >>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.